RNA-sequencing WT vs SOCS3 knockout Glioblastoma stem-cells
Ontology highlight
ABSTRACT:
ORGANISM(S): Homo sapiens
PROVIDER: GSE122486 | GEO | 2019/03/01
REPOSITORIES: GEO
Similar Datasets
Project description:Glioblastoma stem cells were infected with lentivirus expressing a control (gRNA-AAVS1) or MED25 targeting gRNA to assess the role of MED25 in the stem cell compartment of Glioblastoma stem cells. Cells were the subjected to doxycycline-induced ASCL1 overexpression (+DOX) to induced neuronal differentiation.
2023-06-01 | GSE166979 | GEO
Project description:RNA-sequencing WT vs SOCS3 knockout Glioblastoma stem-cells
| PRJNA505341 | ENA
Project description:Cancer stem cells are believed to be responsible for tumor initiation and development. Much current research on human brain tumors is focused on the stem-like properties of glioblastoma stem cells. Anaplastic lymphoma kinase (ALK) and its ligand pleiotrophin are required for maintaining the stem-like properties and tumorigenicity of glioblastoma stem cells. Human glioblastoma stem cells (GB2) were infected with a lentivirus expressing an shRNA targeting ALK or pleiotrophin.
2011-09-30 | E-GEOD-32482 | biostudies-arrayexpress
Project description:Effects of SOCS3 on the transcriptional response of bone marrow-derived macrophages to IL-6. Fetal liver cells from SOCS3+/+ or SOCS3-/- embryos were used to reconstitute recipient mice. Donor derived bone marrow from these mice was differentiated to macrophages. Macrophages were either unstimulated, or stimulated for 100 or 400 minutes with 10 ng/ml IL-6. Keywords = macrophage, SOCS3, IL-6, interferon
2007-11-06 | E-GEOD-411 | biostudies-arrayexpress
Project description:Suppressor of cytokine signaling 3 (SOCS3) down-regulates several signaling pathways in multiple cell types, and previous data suggest that SOCS3 may shut off cytokine activation at the early stages of liver regeneration. We developed hepatocyte-specific Socs3 knockout (Socs3 h-KO) mice to directly study the role of SOCS3 during liver regeneration after 2/3 partial hepatectomy (PH). Socs3 h-KO mice demonstrate marked enhancement of DNA replication and liver weight restoration after 2/3 PH in comparison with littermate controls. Without SOCS3, signal transducer and activator of transcription 3 (STAT3) phosphorylation is prolonged, and activation of the mitogenic kinases extracellular signal-regulated kinase 1/2 (ERK1/2) is enhanced after PH. In vitro, we show that SOCS3 deficiency enhances hepatocyte proliferation in association with enhanced STAT3 and ERK activation after epidermal growth factor (EGF) or interleukin 6 (IL-6) stimulation. Microarray analyses show that SOCS3 modulates a distinct set of genes after PH, which fall into diverse physiologic categories. Using a model of chemical-induced carcinogenesis, we found that Socs3 h-KO mice develop hepatocellular carcinoma (HCC) at an accelerated rate. By acting on cytokines and multiple proliferative pathways, SOCS3 modulates both physiologic and neoplastic proliferative processes in the liver, and may act as a tumor suppressor. Experiment Overall Design: Hepatocyte-specific excision of the Socs3 gene was achieved by breeding Socs3 fl/fl mice with mice expressing the Cre recombinase transgene under control of the albumin promoter (Alb-Cre+), yielding Socs3 h-KO mice. Socs3 fl/fl, Alb-Cre- littermates were used as controls for all experiments, and are henceforth referred to as littermates. All mice (C57BL/6) were free of Helicobacter species, housed in a specific pathogen free facility with 12-h light/dark cycles with free access to standard food and water. 2/3 PH and sham operations were performed as previously described (15, 50) (n=3-6 mice per genotype per time point). Liver remnants were weighed after removal of necrotic stumps and sutures, and compared to post-operative body weight. For HCC experiments, a single i.p. injection of DEN (5mg/kg, Sigma) was performed 12-14 d after birth. For short time points, a single injection of DEN (100mg/kg) (31) was given to 4 wk old mice. At indicated time points, mice were sacrificed by CO2 inhalation. All animal studies were carried out under approved IACUC protocols at the University of Washington.
2008-06-16 | E-GEOD-9549 | biostudies-arrayexpress
Project description:RNA-sequencing (Ribo-ZERO, Illumina HiSeq-2500, single-end 50 bp reads) was on human glioblastoma stem cells (B67) performed 5 days after lentivirus transduction with MISSION TRC lentiviruses using control scrambled (sh002) or two distinct TRIM26 RNAi (TRCN0000004050 (sh4050) and TRCN0000004051 (sh4051)).
2021-08-31 | E-MTAB-10899 | biostudies-arrayexpress
Project description:The paper describes a model of glioblastoma.
Created by COPASI 4.25 (Build 207)
This model is described in the article:
Modeling the Treatment of Glioblastoma Multiforme and Cancer Stem Cells with Ordinary Differential Equations
Kristen Abernathy and Jeremy Burke BMC
Computational and Mathematical Methods in Medicine Volume 2016, Article ID 1239861, 11 pages
Abstract:
Despite improvements in cancer therapy and treatments, tumor recurrence is a common event in cancer patients. One explanation of recurrence is that cancer therapy focuses on treatment of tumor cells and does not eradicate cancer stem cells (CSCs). CSCs are postulated to behave similar to normal stem cells in that their role is to maintain homeostasis. That is, when the population of tumor cells is reduced or depleted by treatment, CSCs will repopulate the tumor, causing recurrence. In this paper, we study the application of the CSC Hypothesis to the treatment of glioblastoma multiforme by immunotherapy. We extend the work of Kogan et al. (2008) to incorporate the dynamics of CSCs, prove the existence of a recurrence state, and provide an analysis of possible cancerous states and their dependence on treatment levels.
To cite BioModels Database, please use: BioModels Database: An enhanced, curated and annotated resource for published quantitative kinetic models .
To the extent possible under law, all copyright and related or neighbouring rights to this encoded model have been dedicated to the public domain worldwide.
Please refer to CC0 Public Domain Dedication for more information.
2019-07-24 | BIOMD0000000757 | BioModels
Project description:Changes in mouse liver mRNA profiles following intraperitoneal cytokine injection. Either interferon-gamma-/-, albumin-cre(-) Socs3(w/fl) mice, or albumin-cre(+) Socs3(-/fl) mice were injected with either phosphate-buffered saline, interferon-gamma, or interfeukin-6, and livers taken after 4h. Keywords = Socs3, interferon gamma, interleukin-6, il6, liver, suppressor of cytokine signalling 3 Keywords: repeat sample
2003-04-10 | GSE369 | GEO
Project description:Making use of a previously described isogenic cancer stem cells and serum differentiated cultures we show that Sox2 controls developmental stated specific programs in glioblastoma. Glioblastoma cells were cultured as control and with SOX2 knockdown to identify the scope of SOX2 interactions. The SOX2 knockdown were accomplished using two knockdown technologies. The knockdown cells were compared to controls, early passage, and scrambled controls. For Sox2 knockdown in low passage 10% FBS cells, the following oligonucleotides targeting human SOX2 coding sequence, or non-silencing control sequence, were cloned into BLOCK-iT Pol II miR RNAi expression vectors (Invitrogen), before cell transfection into GBM monolayer cells using Lipofectamine-2000 (Invitrogen): Sox2miRNA1R:5’CCTGTGCATGGGCTGTCTGCGCTGTCAGTCAGTGGCCAAAACAGCGCAGATGCAGCCCATGCAC Sox2miRNA1F:5’TGCTGTGCATGGGCTGCATCTGCGCTGTTTTGGCCACTGACTGACAGCGCAGACAGCC Sox2miRNA2R:5’CCTGAACCCATGGAGAAGAGCCAGTCAGTCAGTGGCCAAAACTGGCTCTTGGCTCCATGGGTTC Sox2miRNA2F:5’TGCTGAACCCATGGAGCCAAGAGCCAGTTTTGGCCACTGACTGACTGGCTCTTCTCCATGGGTT miRNAnegative:5’GAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCACGCAGTACATTT Sox2 knockdown in neurospheres: GIPZ Lentiviral shRNAmir constructs targeting human Sox2 (clones V3LHS_404430 and V3LHS_404432) and non-silencing control (RHS4346) were obtained (Thermo Scientific Open Biosystems) and lentivirus were prepared according to the manufacturer’s instructions. Sox2 ectopic expression: Sox2 cDNA was subcloned from pCMV6-XL5-NM_002106.2 (Origene) into pcDNA 3.1 mammalian expression vector (Invitrogen), under control of constitutive CMV promoter. Plasmid DNA constructs were stably transfected into GBM monolayer cells using Lipofectamine-2000 (Invitrogen). Control Glioblastoma cells cultured as neurospheres and monolayer early passage are compared to multiple shRNA SOX2 knockdown and multiple miR knockdown cell cultures. A total of 8 samples are analyzed for significant fold change genes identifying gene-gene interactions associated with the SOX2 knockdown. High fold change genes are grouped in lists to be analyzed for network-pathway enrichment. Overlap of significant gene list for each method were analyzed.
2014-07-22 | E-GEOD-51441 | biostudies-arrayexpress
Project description:2 cell populations [slow and fast-cycling cells] were isolated from 3 different patient-derived glioblastoma stem cell lines [L0, L1, L2].
2015-03-24 | ST000248 | MetabolomicsWorkbench