Similar Datasets
Project description:Anopheles aquasalis transcriptome in response to Plasmodium vivax invasion of midgut
2019-06-10 | GSE124997 | GEO
Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed.
2013-04-02 | GSE26941 | GEO
Project description:Transmission of malaria is dependent on the successful completion of the Plasmodium lifecycle in the Anopheles vector. Major obstacles are encountered in the midgut tissue, where most parasites are killed by the mosquito’s immune system. In the present study, DNA microarray analyses have been used to compare Anopheles gambiae responses to invasion of the midgut epithelium by the ookinete stage of the human pathogen Plasmodium falciparum and the rodent experimental model pathogen P. berghei. Invasion by P. berghei had a more profound impact on the mosquito transcriptome, including a variety of functional gene classes, while P. falciparum elicited a broader immune response at the gene transcript level. Ingestion of human malaria-infected blood lacking invasive ookinetes also induced a variety of immune genes, including several anti-Plasmodium factors. Keywords: Anopheles gambiae, Plasmodium falciparum, ookinete, invasion, innate immunity
2007-08-15 | GSE8789 | GEO
Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed. Anopheles gambiae s.s. mosquitoes were reared at 25 M-BM-:C and 75% humidity with a 12-hour light/dark cycle. Adult mosquitoes were maintained on a 10% glucose solution. Three- to four-day-old female mosquitoes were cold-anaesthetized and inoculated intratoraxically with 69nl of a 0.1mM CpG-oligodeoxynucleotide (0604 -5M-bM-^@M-^Y TCCATGACGTTCCTGATGCT 3M-bM-^@M-^Y) solution or with the same volume of elution buffer using a Nanoject micro-injector (Drummond Scientific). Mosquitoes were left to rest for 18h. Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Two independent experiments were performed for each treatment.
2013-04-02 | E-GEOD-26941 | biostudies-arrayexpress
Project description:Plasmodium parasites within mosquitoes are exposed to various physiological processes, such as blood meal digestion activity, the gonotrophic cycle, and host responses preventing the entry of parasites into the midgut wall. However, when in vitro-cultured ookinetes are injected into the hemocoel of mosquitoes, Plasmodium parasites are not affected by the vertebrate host’s blood contents and do not pass through the midgut epithelial cells. This infection method might aid in identifying mosquito-derived factors affecting Plasmodium development within mosquitoes. This study investigated novel mosquito-derived molecules related to parasite development in Anopheles mosquitoes. We injected in vitro-cultured Plasmodium berghei (ANKA strain) ookinetes into female and male Anopheles stephensi (STE2 strain) mosquitoes and found that the oocyst number was significantly higher in males than in females, suggesting that male mosquitoes better support the development of parasites. Next, RNA-seq analysis was performed on the injected female and male mosquitoes to identify genes exhibiting changes in expression. Five genes with different expression patterns between sexes and greatest expression changes were identified as being potentially associated with Plasmodium infection. Two of the five genes also showed expression changes with infection by blood-feeding, indicating that these genes could affect the development of Plasmodium parasites in mosquitoes.
2024-05-06 | GSE197159 | GEO
Project description:Malaria morbidity and mortality caused by both Plasmodium falciparum and Plasmodium vivax extend well beyond the African continent, and, although P. vivax causes 80-300 million severe cases each year, vivax transmission remains poorly understood. Plasmodium parasites are transmitted by Anopheles mosquitoes, and the critical site of interaction between parasite and host is at the mosquito's luminal midgut brush border. While the genome of the "model" African P. falciparum vector, Anopheles gambiae, has been sequenced, evolutionary divergence limits its utility as a reference across anophelines, especially non-sequenced P. vivax vectors such as Anopheles albimanus. Clearly, enabling technologies and platforms that bridge this substantial scientific gap are required in order to provide public health scientists key transcriptomic and proteomic information that could spur the development of novel interventions to combat this disease. To our knowledge, no approaches have been published which address this issue. To bolster our understanding of P. vivax-An. albimanus midgut interactions, we developed an integrated bioinformatic-hybrid RNA-Seq-LC-MS/MS approach involving An. albimanus transcriptome (15,764 contigs) and luminal midgut subproteome (9,445 proteins) assembly, which, when used with our custom Diptera protein database (685,078 sequences), facilitated a comparative proteomic analysis of the midgut brush borders of two important malaria vectors, An. gambiae and An. albimanus. Summary from: http://www.mcponline.org/content/early/2012/10/17/mcp.M112.019596.long The An. albimanus transcriptome dataset is available at http://funcgen.vectorbase.org/RNAseq/Anopheles_albimanus/INSP/v2
2012-11-02 | PXD000062 | Pride
Project description:Transmission of malaria is dependent on the successful completion of the Plasmodium lifecycle in the Anopheles vector. Major obstacles are encountered in the midgut tissue, where most parasites are killed by the mosquito’s immune system. In the present study, DNA microarray analyses have been used to compare Anopheles gambiae responses to invasion of the midgut epithelium by the ookinete stage of the human pathogen Plasmodium falciparum and the rodent experimental model pathogen P. berghei. Invasion by P. berghei had a more profound impact on the mosquito transcriptome, including a variety of functional gene classes, while P. falciparum elicited a broader immune response at the gene transcript level. Ingestion of human malaria-infected blood lacking invasive ookinetes also induced a variety of immune genes, including several anti-Plasmodium factors. By comparing gene expression patterns between carcassess or guts of mosquitoes that fed on a P. falciparum or P. berghei wt and mosquitoes that fed on invasion incapable strains we gain information on the A. gambiae transcriptional responses to the invading ookinete at 24 hours after feeding. By comparing gene expression patterns between carcassess or guts of mosquitoes that fed on a P. falciparum ookinete invasion incapable strain and mosquitoes that fed on non-infected blood we gain information on the A. gambiae transcriptional responses to malaria infected blood in absence of ookinete invasion at 24 hours after feeding. By comparing gene expression patterns between mosquitoes at 4 hours after being injected with either E. coli or S. aureus and mosquitoes injected with sterile PBS we gain information on the mosquito's transcriptional response to these bacterial challenges.
2007-08-15 | E-GEOD-8789 | biostudies-arrayexpress
Project description:A deeper understanding of malaria parasite development inside the Anopheles mosquito may lead to the identification of processes that can be targeted by transmission-blocking interventions. Paraquat (1,1'-dimethyl-4,4'-bipyridylium dichloride) is a potent superoxide-inducing agent that impacts Plasmodium ookinete development, especially at higher concentrations. Compounds like Paraquat can potentially induce an oxidative imbalance in the mosquito midgut during ookinete maturation, essentially super-stressing the parasite leading to the arrested development of ookinetes, the only stage that can invade through a mosquito midgut cell to establish an oocyst infection in the mosquito. The mosquito midgut has evolved to handle the natural production of reactive oxygen and nitrogen species (ROS and RNS, respectively) as a result of feeding on blood. The addition of Paraquat to a bloodmeal is expected to induce a cognate response in the midgut to handle the excess ROS/RNS, and high concentrations of this compound can potentially overwhelm the midgut response leading to mosquito death. While several studies have explored the effect of Paraquat on malaria parasites, a fundamental understanding of the mosquito response to this compound remains unknown. Here, we quantified the mosquito midgut proteomic response to a Paraquat-laced sugar meal to understand the intrinsic midgut response (in the absence of a bloodmeal). We then carried out transcriptomic analysis of the mosquito midgut for several antioxidants of the Trx and GSH pathways to compare concordance or discordance between protein and its transcripts during different oxidative stress conditions. Finally, we determined whether the same Trx and GSH pathways are upregulated following infection with either P. falciparum or P. berghei at 24 hrs post-blood feeding, coinciding with the time point for maximal ookinete traversal of the midgut. We discuss the potential selective action of Paraquat on the parasite and the intrinsic tolerance of the mosquito midgut to Paraquat-mediated oxidative stress.
2022-03-01 | PXD008231 | Pride
Project description:High-throughput sequencing was performed to identify miRNAs profiles of Anopheles anthropophagus midguts after blood feeding and Plasmodium infection. The expression patterns of miRNA in different midgut libraries were compared basing on transcripts per million reads (TPM). This study provides novel regulated miRNAs information of An. anthropophagus during blood feeding and parasite infection
2017-01-13 | GSE93545 | GEO
Project description:Malaria is caused by Plasmodium parasites, which are transmitted via the bites of infected Anopheline mosquitoes. Midgut invasion is a major bottleneck for Plasmodium development inside the mosquito vectors as a rapidly responding immune system recognizes ookinetes and recruits killing factors from the midgut and surrounding tissues, dramatically reducing the population of invading ookinetes before they can successfully traverse the midgut epithelium. Understanding molecular details of the parasite-vector interactions requires precise measurement of nascent protein synthesis in the mosquito during Plasmodium infection. Current expression profiling primarily monitors alterations in steady-state levels of mRNA, but does not address the equally critical issue of whether the proteins encoded by the mRNAs are actually synthesized. In this study, we used sucrose density gradient centrifugation to isolate actively translating Anopheles gambiae mRNAs based upon their association with polyribosomes (polysomes). The proportion of individual gene transcripts associated with polysomes, which is determined by RNA deep sequencing, reflects mRNA translational status. This approach led to identification of 1017 mosquito transcripts that were primarily regulated at the translational level after ingestion of Plasmodium falciparum-infected blood. Caspar, a negative regulator of the NF-kappaB transcription factor Rel2, appears to be substantially activated at the translational levels during Plasmodium infection. In addition, transcripts of Dcr1, Dcr2 and Drosha, which are involved in small RNA biosynthesis, exhibited enhanced associations with polysomes after P. falciparum challenge. This observation suggests that mosquito microRNAs may play an important role in reactions against Plasmodium invasion. We analyzed both total cellular mRNAs and mRNAs that are associated with polysomes to simultaneously monitor transcriptomes and nascent protein synthesis in the mosquito. This approach provides more accurate information regarding the rate of protein synthesis, and identifies some mosquito factors that might have gone unrecognized because expression of these proteins is regulated mainly at the translational level rather than at the transcriptional level after mosquitoes ingest a Plasmodium-infected blood meal.
2012-09-21 | GSE38707 | GEO