Small RNAs from 4-week old seedling of Oryza sativa
Ontology highlight
ABSTRACT:
ORGANISM(S): Oryza sativa
PROVIDER: GSE12317 | GEO | 2008/12/08
SECONDARY ACCESSION(S): PRJNA113547
REPOSITORIES: GEO
Similar Datasets
Project description:In order to identify new miRNAs, NAT-siRNAs and possibly abiotic-stress regulated small RNAs in rice, three small RNA libraries were constructed from control rice seedlings and seedlings exposed to drought or salt stress, and then subjected to pyrosequencing. Totally three sets of small RNAs, which were obtained under normal condition as well as salt and drought stress conditions
2008-12-08 | E-GEOD-12317 | biostudies-arrayexpress
Project description:Chilling stress is a major abiotic stress that affects rice growth and development. Rice seedlings are quite sensitive to chilling stress and this harms global rice production. Comprehensive studies of the molecular mechanisms for response to low temperature are of fundamental importance to chilling tolerance improvement. The number of identified cold regulated genes (CORs) in rice is still very small. Circadian clock is an endogenous timer that enables plants to cope with forever changing surroundings including light–dark cycles imposed by the rotation of the planet. Previous studies have demonstrated that the circadian clock regulates stress tolerances in plants show circadian clock regulation of plant stress tolerances. However, little is known about coordination of the circadian clock in rice chilling tolerance. In this study, we investigated rice responses to chilling stress under conditions with natural light-dark cycles. We demonstrated that chilling stress occurring at nighttime significantly decreased chlorophyll content and photosynthesis efficiency in comparison with that occurring at daytime. Transcriptome analysis characterized novel CORs in indica rice, and suggested that circadian clock obviously interferes with cold effects on key genes in chlorophyll (Chl) biosynthesis pathway and photosynthesis-antenna proteins. Expression profiling revealed that chilling stress during different Zeitberger times (ZTs) at nighttime repressed the expression of those genes involved Chl biosynthesis and photosynthesis, whereas stress during ZTs at daytime increases their expression dramatically. Moreover, marker genes OsDREBs for chilling tolerance were regulated differentially by the chilling stress occurring at different ZTs. The phase and amplitude of oscillation curves of core clock component genes such as OsLHY and OsPRR1 are regulated by chilling stress, suggesting the role of chilling stress as an input signal to the rice circadian clock. Our work revealed impacts of circadian clock on chilling responses in rice, and proved that the effects on the fitness costs are varying with the time in a day when the chilling stress occurs.
2022-03-01 | GSE146174 | GEO
Project description:In this study, we used RNA-Seq to understand the mechanisms of Cd toxicity, cellular detoxification and protection pathways in response to Cd in rice roots. To gain additional insight into the rice transcriptomic response to environmental Cd stress, 15-day-old rice seedlings were treated with 10 or 100 μM solutions of Cd2+, or without Cd (control), for 24 h, at which point root samples were harvested and labeled as Cd+, Cd++, and control, respectively. These samples were used for 101 bp paired-end (PE) deep sequencing on an Illumina HiSeq 2500 platform.
2015-06-08 | E-MTAB-4445 | biostudies-arrayexpress
Project description:The small RNAs presented here were produced as a preliminary exploration of small RNAs in rice, and as such, various tissues and stress conditions were sampled. Small RNAs present in these samples were all mapped to the rice genome TIGR version 5. The total number of distinct mapped sequences are 12879 for Run 1 and 88508 for Run 2. The total number of sequence reads were respectively 70406 and 191682. The datasets contain Oryza sativa var Nipponbar endogenous small RNA sequences in the size range 18 to 34 nt. Plants were grown in a Conviron Environmental Chamber at high light intensity using both high pressure sodium and metal halide lamps for 10.5 hr at 28 degrees C and for 13.5 hr at 26 degrees C in the dark. RNA was extracted from rice tissues at various stages of development and under different abiotic and biotic stresses. The small RNAs presented here were all mapped to the rice genome TIGR version 5. The total number of distinct mapped sequences are 12879 for Run 1 and 88508 for Run 2. The total number of sequence reads were respectively 70406 and 191682. Run 1: A small RNA library was generated from whole cell RNA isolated from inflorescence, 30 and 60 day leaves, 10 and 25 day seedlings and from seedling polysomes using Bartel primers (5' ATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAAT 3'). This was combined with a library derived from whole cell RNA isolated from 30 and 60 day leaves and 10 and 25 day seedlings using Bartel A primers (5' AGCTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATACTG 3'). Run 2: Mixed tissues from unstressed plants. Library prepared from equal amounts of adult root, adult stem and inflorescence from unstressed plants. Amplified with Standard primers (5' ATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAAT 3'). Seedlings stressed by cold, salt desiccation, heat and dark. Tissues were mixed in a 2:2:1:1:1:1 ratio. Amplified with A primers (5' AGCTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATACTG 3'). Kinase library. RNA was isolated from tissues used in 'Adult whole plant' (~30%), 'Stressed' (~25%), from unstressed seedlings of various ages (~15%) from 30 and 60 day leaves (20%) and from immature inflorescence (~10%). RNA isolated from tissues from unstressed plants were treated with polynucleotide kinase before second ligation. This eliminates the dependence of a 5` phosphate as for all the other libraries. Amplified with B primers (5' CAGTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATAGCT 3').
2009-06-07 | E-GEOD-16248 | biostudies-arrayexpress
Project description:The small RNAs presented here were produced as a preliminary exploration of small RNAs in rice, and as such, various tissues and stress conditions were sampled. Small RNAs present in these samples were all mapped to the rice genome TIGR version 5. The total number of distinct mapped sequences are 12879 for Run 1 and 88508 for Run 2. The total number of sequence reads were respectively 70406 and 191682. The datasets contain Oryza sativa var Nipponbar endogenous small RNA sequences in the size range 18 to 34 nt. Plants were grown in a Conviron Environmental Chamber at high light intensity using both high pressure sodium and metal halide lamps for 10.5 hr at 28 degrees C and for 13.5 hr at 26 degrees C in the dark. RNA was extracted from rice tissues at various stages of development and under different abiotic and biotic stresses. The small RNAs presented here were all mapped to the rice genome TIGR version 5. The total number of distinct mapped sequences are 12879 for Run 1 and 88508 for Run 2. The total number of sequence reads were respectively 70406 and 191682.
2009-06-08 | GSE16248 | GEO
Project description:Lysine acetylation is a dynamic and reversible post-translational modification that plays an imporant role in the gene transcription regulation. Here, we report high quality proteome-scale data for lysine-acetylation sites and proteins in rice (Oryza sativa). A total of 1337 Kac sites in 716 Kac proteins with diverse biological functions and subcellular localizations were identified in rice seedlings.
2016-02-24 | PXD002291 | Pride
Project description:Rice is one of the most important global food crops, and is also a model organism for cereal research 31 . Complete genome sequencing of rice, together with advances in transcriptomics and proteomics, has had a dramatic impact on plant growth and 5 breeding programs 32 . Genomic analysis of DNA methylation in rice has revealed methylation patterns associated with gene bodies and promoters, and the occurrence of high levels of DNA methylation in the centromeric domain 33 . A genome-wide investigation of acetylation in rice revealed that H3K9ac and H3K27ac are mainly enriched at transcription start sites associated with active transcription 34 . Furthermore, global proteome analysis has shown that phosphorylation and succinylation are involved in diverse cellular and metabolic processes 35, 36 . However, despite these considerable advances in our knowledge, additional large-scale analysis of the lysine acetylome in rice is expected to identify many more Kac sites and acetylated proteins in this improtant crop plant. In this study, affinity enrichment and high-resolution LC-MS/MS were used for large-scale analysis of the lysine acetylome in rice variety Nipponbare. In total, 1353 lysine acetylation sites were detected in 866 protein groups in rice seedlings. Proteomic analysis showed that Kac occurs in proteins involved in diverse biological processes with varied cellular functions and subcellular localization.
2017-11-13 | PXD004870 | Pride
Project description:Fairy rings are zones of stimulated grass growth by the interaction between the fungi and the plant. In the previous research, we reported the identification of the “fairy”, 2-azahypoxanthine (AHX), produced by the fairy ring-forming fungus and the mechanism of its growth-promoting activity using DNA microarray. We discovered AOH, a common metabolite of AHX in plants. We investigate expression profiling of rice seedlings treated with AHX or AOH for the mechanism of their growth-promoting activity.
2014-01-01 | GSE38844 | GEO
Project description:Fairy rings are zones of stimulated grass growth by the interaction between the fungi and the plant. In the previous research, we reported the identification of the “fairy”, ICAproduced by the fairy ring-forming fungus and the mechanism of its growth-inhibiting activity using DNA microarray. We invetigate expression profiling of rice seedlings treated with ICA for the mechanism of its growth-inhibiting activity.
2019-07-26 | GSE100899 | GEO
Project description:Expression data for stress treatment in rice seedlings
| PRJNA98147 | ENA