Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

A gain-of-function p53 mutant oncogene promotes cell fate plasticity and myeloid leukemia through the pluripotency factor Foxh1

ABSTRACT: Mutations in the TP53 tumor suppressor gene are common in many cancer types, including the acute myeloid leukemia (AML) subtype known as complex karyotype (CK) AML. Here, we identify a gain-of-function (GOF) p53 mutation that accelerates CK-AML initiation beyond p53 loss and, surprisingly, is required for disease maintenance. The p53R172H mutation (TP53R175H in humans) exhibits a neomorphic function by promoting aberrant self-renewal in leukemic cells, a phenotype that is present in hematopoietic stem and progenitor cells (HSPCs) even prior to their transformation. We identify the Forkhead box H1 transcription factor (Foxh1) as a critical mediator of mutant p53 function that binds to and regulates stem cell-associated genes and transcriptional programs. Our results identify a context where mutant p53 acts as a bona fide oncogene that contributes to the pathogenesis of CK-AML and suggests a common biological theme for TP53 gain-of-function in cancer.

ORGANISM(S): Mus musculus

PROVIDER: GSE125097 | GEO | 2019/05/08

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Similar Datasets

Altered miRNA and gene expression in acute myeloid leukemia with complex karyotype identify networks of prognostic relevance

Project description:Recently, the p53-miR-34a network was identified to play an important role in tumorigenesis. As in acute myeloid leukemia with complex karyotype (CK-AML) TP53 alterations are the most common known molecular lesion, we further analyzed the p53-miR-34a axis in CK-AML with known TP53 status. Clinically, low miR-34a expression and TP53 alterations predicted for chemotherapy resistance and inferior outcome. Notably, in TP53unaltered CK-AML high miR-34a expression predicted for inferior overall survival (OS), whereas in TP53biallelic altered CK-AML high miR-34a expression pointed to better OS. To further investigate miR-34a-associated gene expression patterns, we analyzed distinct subgroups defined by TP53 alteration and miR-34a expression status. Exemplary samples from TP53unaltered (n=6) and TP53biallelic altered (n=6) CK-AML characterized by either high (CK+/miR-34ahigh expression, above median miR-34a expression of the entire cohort), or low (CK+/miR-34alow expression, below median miR-34a expression of the entire cohort) miR-34a expression (n=3 in each group), were analyzed. This molecular profiling linked impaired p53 to decreased miR-34a expression but also identified p53-independent miR-34a induction mechanisms, as shown in TP53biallelic altered cell lines treated with 15-deoxy-∆12,14-prostaglandin (PGJ2). An improved understanding of this mechanism might provide novel therapeutic options to restore miR-34a function and thereby induce cell cycle arrest and apoptosis in TP53altered CK-AML. All samples were obtained from untreated patients at the time of diagnosis. Cells used for microarray analysis were collected from the purified fraction of mononuclear cells after Ficoll density centrifugation. Routine diagnostic algorithms, including the characterization of molecular markers are performed.

2012-08-02 | E-GEOD-39730 | biostudies-arrayexpress

Altered miRNA and gene expression in acute myeloid leukemia with complex karyotype identify networks of prognostic relevance

2012-08-03 | GSE39730 | GEO

Mouse oral tumors induced by activation of Ras and p53 mutations

Project description:The p53 gain of function p53R172H promotes accelerated tumor growth and progression to carcinoma. To identify gene expression changes associated with the oncogenic function of mutant p53 we compared the expression profiles of oral tumors induced by activation of oncogenic K-ras and p53 gain- or loss-of-function mutations Oral tumors were induced by activation of endogenous oncogenic K-rasG12D and p53 loss- or gain-of-function mutations (p53R172H) Oral tumors from mice carrying the p53R172H mutation or deletion of p53 were collected for gene expression analysis

2012-03-30 | E-GEOD-28203 | biostudies-arrayexpress

Mouse oral tumors induced by activation of Ras and p53 mutations

2012-03-31 | GSE28203 | GEO

Affymetrix SNP array data for acute myeloid leukemia (AML) samples with complex karyotype

Project description:AML with complex karyotype (CK-AML) is characterized by a high frequency of TP53 alteration (loss and/or mutation). TP53-altered CK-AML were characterized by a higher degree of genomic complexity (aberrations per case, 14.30 vs. 6.16; P<.0001), and by a higher frequency of specific copy number alterations, such as -5/5q-, -7/7q-, -16/16q-, -18/18q-, +1/+1p, and +11/+11q/amp11q13~25; among CK-AML, TP53-altered more frequently exhibited a monosomal karyotype (MK). Patients with TP53 alterations were older and had significantly lower complete remission rates, inferior event-free, relapse-free, and overall survival. In multivariable analysis for overall survival, TP53 alterations, white blood cell counts, and age were the only significant factors. In conclusion, TP53 is the most frequently known altered gene in CK-AML. TP53 alterations are associated with older age, genomic complexity, specific DNA copy number alterations, MK, and dismal outcome. In multivariable analysis, TP53 alteration is the most important prognostic factor in CK-AML, outweighing all other variables, including the MK category.

2012-08-27 | GSE34542 | GEO

A gain-of-function p53 mutant synergizes with oncogenic Nras to promote acute myeloid leukemia in mice

Project description:We previously demonstrated that a subset of acute myeloid leukemia (AML) patients with concurrent RAS pathway and TP53 mutations have extremely poor prognosis, and most of these TP53 mutations are missense mutations. Here, we report that in contrast to mixed AML and T-cell malignancy developed in NrasG12D/+; p53-/- (NP-/-) mice, NrasG12D/+; p53R172H/+ (NPmut) mice rapidly developed an inflammation-associated AML. Under the inflammatory conditions, NPmut hematopoietic stem and progenitor cells (HSPCs) displayed imbalanced myelopoiesis and lymphopoiesis and largely normal cell proliferation despite MEK/ERK hyperactivation. RNA-Seq analysis revealed that NrasG12D signaling and p53mut synergize to establish an NPmut-AML transcriptome distinct from that of NA-/- cells. The NPmut-AML transcriptome showed GATA2 downregulation and elevated expression of inflammatory genes, including those linked to NFΚB signaling. NFΚB was also upregulated in human NRAS;TP53 AML. Exogenous expression of GATA2 in human NPmut KY821 AML cells downregulated inflammatory gene expression. Mouse and human NPmut AML cells were sensitive to MEK and NFΚB inhibition in vitro. The proteasome inhibitor bortezomib stabilized NFΚB inhibitory protein IΚBɑ mitigated inflammatory gene expression, and potentiated the survival benefit of a MEK inhibitor in NPmut mice. Our study demonstrates that a p53 structural mutant synergizes with NrasG12D to promote AML through mechanisms distinct from p53 loss.

2023-09-25 | GSE243642 | GEO

Expression data from salivary tumor tissues derived from MMTV-ras transgenic mice with wild-type p53, no p53 or gain-of-function mutant p53

Project description:Salivary tumors isolated from MMTV-ras transgenic mice expressing wild-type p53, no p53 or p53R172H gain-of-funcion mutant were subjected to genome-wide gene expression profiling to assess the effect of the different p53 status on tumor gene expression. A total of 12 spontaneous salivary tumors from MMTV-ras/p53+/+, MMTV-ras/p53-/- or MMTV-ras/p53R172H/R172H mice (4 tumors per genotype) were analyzed using Affymetric GeneChip for gene expression profiling. The multi-class comparison function of Significance Analysis of Microarray (SAM) with an FDR of 1% was used to identify genes that are differentially regulated across the three genotypic groups.

2014-08-15 | E-GEOD-59452 | biostudies-arrayexpress

HEB and E2A function as SMAD/FOXH1 cofactors

Project description:Nodal signaling, mediated through SMAD transcription factors, is necessary for pluripotency maintenance and endoderm commitment. We have identified a new motif, termed SMAD Complex Associated (SCA) that is bound by SMAD2/3/4 and FOXH1 in human embryonic stem cells (hESCs) and derived endoderm. We demonstrate that two bHLH proteins - HEB and E2A - bind the SCA motif at regions overlapping SMAD2/3 and FOXH1. Further, we show that HEB and E2A associate with SMAD2/3 and FOXH1, suggesting they form a complex at critical target regions. This association is biologically important, as E2A is critical for mesendoderm specification, gastrulation, and Nodal signal transduction in Xenopus tropicalis embryos. Taken together, E2A is a novel Nodal signaling cofactor that associates with SMAD2/3 and FOXH1 and is necessary for mesendoderm differentiation. ChIP-seq of Smad2/3 and Input in X.tropicalis, stage 10.5 embryo.

2011-08-23 | E-GEOD-30146 | biostudies-arrayexpress

Mutant p53 interactome study with IP-MS

Project description:Inactivating TP53 mutations lead to a loss of function of p53, but can also often result in oncogenic gain-of-function (GOF) of mutant p53 (mutp53) proteins which promote tumor development and progression. The GOF activities of TP53 mutations are well documented, but the mechanisms involved remain poorly understood. Here, we study the mutp53 interactome with IP-MS.

2023-11-27 | PXD047094 | Pride

Identification of differentially-expressed genes between FoxH1 morpholino and control in zebrafish embryos.

Project description:The Forkhead Box H1 (FoxH1) protein is a co-transcription factor recruited by phosphorylated Smad2 downstream of several TGFbetas, including Nodal-related proteins. We have reassessed the function of zebrafish FoxH1 using antisense morpholino oligonucleotides (MOs) ( 5’ TGCTTTGTCATGCTGATGTAGTGGG 3’) as compared with a control morpholino (MO) with no specific target (5’ TAGTTAAGCCTAGCTCTCATAAACT 3’). Probing FoxH1 morphant RNA by microarray, we identified a cohort of five keratin genes – cyt1, cyt2, krt4, krt8 and krt18 - that are normally transcribed in the embryo’s enveloping layer (EVL) and which have significantly reduced expression in FoxH1-depleted embryos. Keywords: 40% epiboly-stage embryos, injected with either 8 ng of a 25mer morpholino (MO) with no specific target or 8 ng of a 25mer MO with reverse complementary to the 5’ untranslated region of the zebrafish foxH1 gene.

2007-07-30 | GSE8076 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data