RNAseq & Smad and Foxh1 ChIpseq in pluripotent mESC and EBs
Ontology highlight
ABSTRACT:
ORGANISM(S): Mus musculus
PROVIDER: GSE125116 | GEO | 2019/09/05
REPOSITORIES: GEO
Similar Datasets
Project description:RNAseq & Smad and Foxh1 ChIpseq in pluripotent mESC and EBs
| PRJNA515268 | ENA
Project description:Nodal signaling, mediated through SMAD transcription factors, is necessary for pluripotency maintenance and endoderm commitment. We have identified a new motif, termed SMAD Complex Associated (SCA) that is bound by SMAD2/3/4 and FOXH1 in human embryonic stem cells (hESCs) and derived endoderm. We demonstrate that two bHLH proteins - HEB and E2A - bind the SCA motif at regions overlapping SMAD2/3 and FOXH1. Further, we show that HEB and E2A associate with SMAD2/3 and FOXH1, suggesting they form a complex at critical target regions. This association is biologically important, as E2A is critical for mesendoderm specification, gastrulation, and Nodal signal transduction in Xenopus tropicalis embryos. Taken together, E2A is a novel Nodal signaling cofactor that associates with SMAD2/3 and FOXH1 and is necessary for mesendoderm differentiation. ChIP-seq of Smad2/3 and Input in X.tropicalis, stage 10.5 embryo.
2011-08-23 | E-GEOD-30146 | biostudies-arrayexpress
Project description:Nodal signaling, mediated through SMAD transcription factors, is necessary for pluripotency maintenance and endoderm commitment. We have identified a new motif, termed SMAD Complex Associated (SCA) that is bound by SMAD2/3/4 and FOXH1 in human embryonic stem cells (hESCs) and derived endoderm. We demonstrate that two bHLH proteins - HEB and E2A - bind the SCA motif at regions overlapping SMAD2/3 and FOXH1. Further, we show that HEB and E2A associate with SMAD2/3 and FOXH1, suggesting they form a complex at critical target regions. This association is biologically important, as E2A is critical for mesendoderm specification, gastrulation, and Nodal signal transduction in Xenopus tropicalis embryos. Taken together, E2A is a novel Nodal signaling cofactor that associates with SMAD2/3 and FOXH1 and is necessary for mesendoderm differentiation.
2011-08-23 | GSE30146 | GEO
Project description:Morphogen gradients expose cells to different signal concentrations and induce target genes with different ranges of expression. To determine how the Nodal morphogen gradient induces distinct gene expression patterns during zebrafish embryogenesis we characterized the binding sites of the Nodal-specific transcription co-activators Smad2 and FoxH1 in wild-type, Nodal-overexpressing or Nodal signaling inhibited embryos. We found that FoxH1 binds to Nodal targets loci even in the absence of the signal, while Smad2 only binds and colocalizes to FoxH1 upon induction of the Nodal pathway.
2015-04-08 | GSE67648 | GEO
Project description:We defined the genome-wide binding regions of Smad2/3 and Foxh1 at mid-gastrula stage Xenopus tropicalis embryos, at which Nodal signaling and Foxh1 are critical in mesendoderm specification program.
2014-11-07 | GSE53652 | GEO
Project description:We examined the binding dynamics of the maternal TF Foxh1 over a time course of germ layer development. Foxh1 binding was compared to the onset of zygotic transcription (RNA pol II), binding of the co-repressor Tle, Nodal signaling (Smad2/3) and the zygotic endoderm TF Foxa.
2017-03-30 | GSE85273 | GEO
Project description:To elucidate the Nodal transcriptional network that governs endoderm formation, we used ChIP-Seq to identify genomic targets for SMAD2/3, SMAD3, SMAD4, FOXH1 and the active and repressive chromatin marks, H3K4me3 and H3K27me3, in human embryonic stem cells (hESCs) and derived endoderm. We demonstrate that while SMAD2/3, SMAD4 and FOXH1 target binding is highly dynamic, there is an optimal signature for driving endoderm commitment. Initially, this signature is marked by both H3K4me3 and H3K27me3 as a very broad bivalent domain in hESCs. Within the first 24 hours, at a few select promoters, SMAD2/3 accumulation coincides with H3K27me3 depletion so that these loci become selectively monovalent marked only by H3K4me3. The correlation between SMAD2/3 binding, monovalent formation and transcriptional activation suggests a mechanism by which SMAD proteins coordinate with chromatin at critical promoters to drive endoderm specification. Examination of 2 different histone modifications and 4 different transcription factor associations in 2 cell types. For transcription factor analysis, three biological replicate ChIPs were pooled from each antibody, as well as input controls, for both hESCs and derived endoderm. For histone modifications, two biological replicates for H3K4me3 and three for H3K27me3 were used.
2011-05-21 | E-GEOD-29422 | biostudies-arrayexpress
Project description:To elucidate the Nodal transcriptional network that governs endoderm formation, we used ChIP-Seq to identify genomic targets for SMAD2/3, SMAD3, SMAD4, FOXH1 and the active and repressive chromatin marks, H3K4me3 and H3K27me3, in human embryonic stem cells (hESCs) and derived endoderm. We demonstrate that while SMAD2/3, SMAD4 and FOXH1 target binding is highly dynamic, there is an optimal signature for driving endoderm commitment. Initially, this signature is marked by both H3K4me3 and H3K27me3 as a very broad bivalent domain in hESCs. Within the first 24 hours, at a few select promoters, SMAD2/3 accumulation coincides with H3K27me3 depletion so that these loci become selectively monovalent marked only by H3K4me3. The correlation between SMAD2/3 binding, monovalent formation and transcriptional activation suggests a mechanism by which SMAD proteins coordinate with chromatin at critical promoters to drive endoderm specification.
2011-05-21 | GSE29422 | GEO
Project description:The Forkhead Box H1 (FoxH1) protein is a co-transcription factor recruited by phosphorylated Smad2 downstream of several TGFbetas, including Nodal-related proteins. We have reassessed the function of zebrafish FoxH1 using antisense morpholino oligonucleotides (MOs) ( 5’ TGCTTTGTCATGCTGATGTAGTGGG 3’) as compared with a control morpholino (MO) with no specific target (5’ TAGTTAAGCCTAGCTCTCATAAACT 3’). Probing FoxH1 morphant RNA by microarray, we identified a cohort of five keratin genes – cyt1, cyt2, krt4, krt8 and krt18 - that are normally transcribed in the embryo’s enveloping layer (EVL) and which have significantly reduced expression in FoxH1-depleted embryos. Keywords: 40% epiboly-stage embryos, injected with either 8 ng of a 25mer morpholino (MO) with no specific target or 8 ng of a 25mer MO with reverse complementary to the 5’ untranslated region of the zebrafish foxH1 gene.
2007-07-30 | GSE8076 | GEO
Project description:Gene-specific transcription factors (GSTFs) control of gene transcription by DNA binding and specific protein complex recruitment, which regulates promoter accessibility for transcription initiation by RNA polymerase II. GSTFs that are frequently mutated in colon and rectal carcinomas are Suppressor of Mothers Against Decapentaplegic 2 (SMAD2) and SMAD4, which play an important role in the TGF-β signaling pathways controlling cell fate and proliferation (ref.). The SMAD protein family is a diverse and it can be divided into three subclasses: receptor activated SMADs, inhibitory SMADs and the common SMAD4 co-activator. To study protein interactors of the SMAD protein family we generated a quantitative proteomics pipeline that allows for inducible expression of GFP-tagged SMAD proteins followed by affinity purification and MS analysis. The nuclear importin IPO5 was identified as a novel interacting protein of SMAD1. Overexpression of IPO5 shows forced BMP R-SMAD nuclear localization confirming a functional relationship between BMP but not TGF-β R-SMADs and IPO5. Finally we provide evidence that the length of the lysine stretch in the NLS is involved in importin selection.
2016-10-10 | PXD004529 | Pride