Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

RNA-seq analysis of control and ZC3H18-depleted ovarian cancer cells

ABSTRACT: We report the differential gene expression in control versus ZC3H18-depleted OVCAR-8 cells

ORGANISM(S): Homo sapiens

PROVIDER: GSE136533 | GEO | 2019/08/29

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

RNA-seq analysis of control and CDK12-depleted ovarian cancer cells

Project description:We report the differential gene expression in control versus CDK12-depleted OVCAR-8 cells

2019-10-03 | GSE138288 | GEO

RNA-seq analysis of control and ZC3H18-depleted ovarian cancer cells

Project description:RNA-seq analysis of control and ZC3H18-depleted ovarian cancer cells

| PRJNA562626 | ENA

Profiling of differential RNAs in alpha amanitin treated SORBS2-depleted ovarian cancer cells and control-treated SORBS2-depleted

Project description:In this study, we examined the differential RNA profile of alpha amanitin-treated SORBS2-depleted ovarian cancer cells compared with control-treated SORBS2-depleted cells

2018-02-20 | GSE101595 | GEO

Profiling of differential RNAs in SORBS2-depleted ovarian cancer cells and control cells

Project description:In this study, we examined the differential RNA profile of SORBS2-depleted ovarian cancer cells compared with control cells

2018-02-20 | GSE101594 | GEO

RNA-seq analysis of differentially expressed genes between WT and KD ZC3H18 KYSE150/ECA109 cells.

Project description:Small interfering RNAs (siRNAs) targeting ZC3H18 were purchased from Suzhou Hongxun Biotechnology Co., Ltd. (Suzhou, China), with an empty vector serving as the control (si-nc). ZC3H18 siRNA sequences were GGGGTGAGGGCTTCTGATCT and TCGTCGGAGTGATTATCTTCCT. These siRNAs were introduced into KYSE150 and ECA109 cells using DharmaFect1 (Suzhou Hongxun Biotechnology Co., Ltd., Suzhou, China).

2025-02-21 | GSE290209 | GEO

Dual agonistic and antagonistic roles of ZC3H18 provides for co-activation of distinct nuclear RNA decay pathways

Project description:The RNA exosome is a versatile ribonuclease. In the nucleoplasm of mammalian cells, it is assisted by its adaptors the Nuclear EXosome Targeting (NEXT) complex and the PolyA eXosome Targeting (PAXT) connection. Via its association with the ARS2 and ZC3H18 proteins, NEXT/exosome is recruited to capped and short unadenylated transcripts. Conversely, PAXT/exosome was considered to target longer and adenylated substrates via their poly(A) tails. Here, mutational analysis of the core PAXT component ZFC3H1 uncovers a separate branch of the PAXT pathway, which targets short adenylated RNAs and relies on a direct ARS2-ZFC3H1 interaction. We further demonstrate that similar acidic-rich short linear motifs of ZFC3H1 and ZC3H18 compete for a common ARS2 epitope. Consequently, while promoting NEXT function, ZC3H18 antagonizes PAXT activity. We suggest that this unprecedented organization of RNA decay complexes provides co-activation of NEXT and PAXT at loci with abundant production of short exosome substrates.

2024-01-26 | PXD045842 | Pride

Dual agonistic and antagonistic roles of ZC3H18 provides for co-activation of distinct nuclear RNA decay pathways

2023-09-26 | GSE212557 | GEO

Gene expression profiling of N-acetylglucosaminidase (NAGLU)-depleted HeLa cells versus non-depleted cells

Project description:We generated a HeLa cell model of mucopolysaccharidosis IIIB (MPSIIIB) by depleting NAGLU. MPSIIIB-associated cell defects were prominent in NAGLU-depleted cells. We explored alterations of metabolic pathways in NAGLU-depleted cells versus non-depleted control cells by performing gene expression profiling. Exon array transcriptome analysis showed 96 transcripts with increased expression level and 38 transcripts with decreased expression level in NAGLU-depleted versus non-depleted cells.

2012-09-13 | GSE32154 | GEO

Transcriptional responses to TNF following HFol treatment of wild type and GCN2 depleted synoviocytes

Project description:We report the effects of Hfol on TNF induction of inflammatory genes in wild type cells versus cells depleted of GCN2 RNA-seq analysis of wild type or GCN2-depleted established fibroblast like synoviocytes (K4 cells) treated with TNFa in the presence or absence of Halofuginone (HF).

2020-03-22 | GSE145203 | GEO

Gene expression profiling of N-acetylglucosaminidase (NAGLU)-depleted HeLa cells versus non-depleted cells

2012-09-13 | E-GEOD-32154 | biostudies-arrayexpress