Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Primate cell fusion disentangles gene regulatory divergence in neural development

ABSTRACT: Among primates, humans display a unique trajectory of development responsible for the many traits specific to our species. However, the inaccessibility of human and chimpanzee primary tissues has limited our ability to study human evolution. Comparative in vitro approaches using primate-derived induced pluripotent stem cells have begun to reveal species differences on the cellular and molecular levels. In particular, brain organoids have emerged as a promising platform to study primate neural development in vitro, although cross-species comparisons of organoids are complicated by differences in developmental timing and variability of differentiation. Here, we developed a new platform to address these limitations. We first generated a panel of tetraploid hybrid stem cells by fusing human and chimpanzee induced pluripotent stem cells. We next applied this approach to study species divergence in cerebral cortical development by differentiating them into neural organoids. We found that hybrid organoids provide a controlled system for disentangling cis- and trans-acting gene expression divergence across cell types and developmental stages, revealing a signature of selection on astrocyte-related genes. In addition, we identified an up-regulation of human somatostatin receptor 2 (SSTR2), which regulates neuronal calcium signaling and is associated with neuropsychiatric disorders. We discovered a human-specific response to modulation of SSTR2 function in cortical neurons, underscoring the potential of this unique platform to reveal the molecular basis of human evolution.

ORGANISM(S): Homo sapiens Pan troglodytes

PROVIDER: GSE144825 | GEO | 2020/11/17

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Similar Datasets

Single cell RNA-seq of great ape cerebral organoids

Project description:The human brain has changed dramatically from other primate species, but the genetic and developmental mechanisms behind the differences remains unclear. Here we used single cell RNA sequencing based on 10X technology to explore temporal transcriptomic dynamics and cellular heterogeneity in cerebral organoids derived from human and non-human primates chimpanzee and rhesus macaque stem cells. Using cerebral organoids as a proxy of early brain development, we detect a delayed pace of human brain development relative to the other two primate species. Additional human-specific gene expression patterns resolved to different cell states through progenitors to neurons are also found. Our data provide a transcriptomic cell atlas of primate early brain development, and illustrate features that are unique to humans.

2019-12-30 | E-MTAB-7552 | biostudies-arrayexpress

Single cell RNA-seq of great ape cerebral organoids

2019-10-04 | E-MTAB-8234 | biostudies-arrayexpress

Establishing Cerebral Organoids as Models of Human-Specific Brain Evolution

Project description:Direct comparisons of human and non-human primate brain tissue have the potential to reveal molecular pathways underlying remarkable specializations of the human brain. However, chimpanzee tissue is largely inaccessible during neocortical neurogenesis when differences in brain size first appear. To identify human-specific features of cortical development, we leveraged recent innovations that permit generating pluripotent stem cell-derived cerebral organoids from chimpanzee. First, we systematically evaluated the fidelity of organoid models to primary human and macaque cortex, finding organoid models preserve gene regulatory networks related to cell types and developmental processes but exhibit increased metabolic stress. Second, we identified 261 genes differentially expressed in human compared to chimpanzee organoids and macaque cortex. Many of these genes overlap with human-specific segmental duplications and a subset suggest increased PI3K/AKT/mTOR activation in human outer radial glia. Together, our findings establish a platform for systematic analysis of molecular changes contributing to human brain development and evolution.

2019-02-07 | GSE124299 | GEO

Extensive Evolutionary Changes in Regulatory Element Activity during Human Origins Are Associated with Altered Gene Expression and Positive Selection [Dnase-seq]

Project description:The human genome shares a remarkable amount of genomic sequence with our closest living primate relatives. Researchers have long sought to understand what regions of the genome are responsible for unique species-specific traits. Previous studies have shown that many genes are differentially expressed between species, but the regulatory elements contributing to these differences are largely unknown. Here we report a genome-wide comparison of active gene regulatory elements in human, chimpanzee, and macaque, and we identify hundreds of regulatory elements that have been gained or lost in the human or chimpanzee genomes since their evolutionary divergence. These elements contain evidence of natural selection and correlate with species-specific changes in gene expression. Polymorphic DNA bases in transcription factor motifs that we found in these regulatory elements may be responsible for the varied biological functions across species. This study directly links phenotypic and transcriptional differences between species with changes in chromatin structure. One biological replicate was analyzed for each of the 15 primate samples using DNase-seq.

2014-02-13 | E-GEOD-54907 | biostudies-arrayexpress

Human-chimpanzee hybrid cells reveal gene regulatory evolution underlying skeletal divergence

Project description:Gene regulatory divergence is thought to play a central role in determining human-specific traits. However, our ability to link divergent regulation to divergent phenotypes is limited. Here, we utilized human-chimpanzee hybrid induced pluripotent stem cells to study divergent gene expression separating these species. The hybrid cells allowed us to separate cis- from trans-regulatory effects, and to control for non-genetic factors that often confound comparative studies. We differentiated these cells into cranial neural crest cells (CNCCs), the primary cell type giving rise to the face, and used the hybrid cells to generate a catalogue of divergent cis-regulatory gene expression between humans and chimpanzees. We found that cis-regulatory divergence is tightly linked to phenotypic divergence, enabling the identification of candidate genes associated with several divergent traits. Specifically, we find support for lineage-specific selection acting on the cis-regulation of the hedgehog signaling pathway. This pathway includes EVC2 (LIMBIN), whose cis-regulation is among the most divergent in the genome, resulting in 6-fold down-regulation along the human lineage. We found that inducing a similar reduction in EVC2 levels substantially reduces Hh signaling output. Mice and humans lacking functional EVC2 show striking parallels to many human-chimpanzee phenotypic differences, particularly in the skull and face, suggesting that the regulatory divergence of Hh signaling may have contributed to the unique craniofacial morphology of humans. In sum, our results suggest that human-chimpanzee hybrid cells can serve as a valuable resource to study the evolution of gene regulation and its impact on phenotypic divergence. SRA/fastq files include Illumina adapters (GATCGGAAGAGCACACGTCT and GATCGGAAGAGCGTCGTGTA).

2020-10-09 | GSE146481 | GEO

Extensive Evolutionary Changes in Regulatory Element Activity during Human Origins Are Associated with Altered Gene Expression and Positive Selection [DGE-seq]

2014-02-13 | E-GEOD-54906 | biostudies-arrayexpress

Primate transcript and protein expression levels evolve under compensatory selection pressures

Project description:Variation in gene regulation is thought to have played an important role in the evolution of primates, and many studies have documented differences in mRNA expression levels across primate species. However, it is not yet known to what extent measurements of divergence in mRNA levels reflect divergence in protein expression levels, which are more directly tied to phenotypic differences. To address this question, we used high-resolution, quantitative mass spectrometry to collect thousands of protein expression measurements from human, chimpanzee, and rhesus macaque lymphoblastoid cell lines (LCLs). We also used RNA sequencing to collect transcript expression data from the same samples. Considering the two datasets jointly we found that there is much more inter-species divergence at the mRNA level than at the protein level. Remarkably, we found dozens of genes with significant expression differences between species at the mRNA level yet little or no difference in protein expression. Overall, our data suggest a much stronger evolutionary constraint on protein expression levels than on mRNA levels. We conclude that inter-species mRNA expression differences may often have limited functional consequences due to either buffering or compensatory changes in post-transcriptional or posttranslational regulation of proteins. Gene expression patterns were compared between human, chimpanzee, and rhesus macaque lymphoblastoid cell lines (5 individuals from each species) using RNA-Seq. These gene expression patterns were also compared to protein expression patterns based on mass-spec data, which are available separately (see publication for details).

2013-10-17 | E-GEOD-49682 | biostudies-arrayexpress

Extensive Evolutionary Changes in Regulatory Element Activity during Human Origins Are Associated with Altered Gene Expression and Positive Selection [DGE-seq]

2014-02-13 | GSE54906 | GEO

Extensive Evolutionary Changes in Regulatory Element Activity during Human Origins Are Associated with Altered Gene Expression and Positive Selection [Dnase-seq]

2014-02-13 | GSE54907 | GEO

Single-cell RNA-seq in a comparative primate skeletal cell culture model [2]

Project description:We evaluated the degree to which gene expression patterns in primate skeletal cells differ across cell types and species. First, we optimized differentiation protocols of human and chimpanzee iPSCs through an intermediate MSC state and into osteogenic cells. Single-cell RNA sequencing was collected from each stage of differentiation (iPSCs, MSCs, and osteogenic cells) using the 10X Genomics platform to characterize gene expression variation.

2022-02-10 | GSE181743 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data