Identifying cleaved and noncleaved targets of small interfering RNAs and microRNAs in mammalian cells by SpyCLIP
Ontology highlight
ABSTRACT:
ORGANISM(S): Homo sapiens
PROVIDER: GSE145438 | GEO | 2020/12/01
REPOSITORIES: GEO
Similar Datasets
Project description:microRNAs (miRNAs) are typically generated as ~22-nucleotide double-stranded RNAs via processing of precursor hairpins by the RNase III enzyme Dicer, after which they are loaded into Argonaute (Ago) proteins to form RNA-induced silencing complex (RISC). However, the biogenesis of miR-451, an erythropoietic miRNA conserved in vertebrates, does not require Dicer processing. Instead, the short pre-miR-451 precursor hairpin is directly loaded into Ago, followed by cleavage of the 3' arm and trimming of the 3' end to the mature length by PARN. Here we show the in vivo activity of miR-430 Ago2-hairpin, a canonical microRNA engineered to fit the structure of miR-451 and hence become Ago2-dependent. Moreover, we test a modified miR-430 Ago2-haipin with 3x phoshorothioate bonds that impairs trimmng. Surprisingly, our data show that trimming of Ago-cleaved pre-miRNAs is not essential for target silencing, indicating that RISC is functional with miRNAs longer than 22-nucleotides. Rescue of MZdicer zebrafish mutant with the injection of trimmable and nontrimmable miR-430 Ago2 hairpins: Transcriptome of wild type, MZdicer mutant, and MZdicer mutant micoinjected with miR-430 duplex, miR-430 (Ago2-haripin), miR-430 (Ago2-haripin 3xPhosphorothioate)
2013-11-13 | E-GEOD-51036 | biostudies-arrayexpress
Project description:microRNAs (miRNAs) are typically generated as ~22-nucleotide double-stranded RNAs via processing of precursor hairpins by the RNase III enzyme Dicer, after which they are loaded into Argonaute (Ago) proteins to form RNA-induced silencing complex (RISC). However, the biogenesis of miR-451, an erythropoietic miRNA conserved in vertebrates, does not require Dicer processing. Instead, the short pre-miR-451 precursor hairpin is directly loaded into Ago, followed by cleavage of the 3' arm and trimming of the 3' end to the mature length by PARN. Here we show the in vivo activity of miR-430 Ago2-hairpin, a canonical microRNA engineered to fit the structure of miR-451 and hence become Ago2-dependent. Moreover, we test a modified miR-430 Ago2-haipin with 3x phoshorothioate bonds that impairs trimmng. Surprisingly, our data show that trimming of Ago-cleaved pre-miRNAs is not essential for target silencing, indicating that RISC is functional with miRNAs longer than 22-nucleotides.
2013-11-13 | GSE51036 | GEO
Project description:In Drosophila, the siRNA pathway is initiated when exogenous or endogenous double stranded RNA (dsRNA) is processed into siRNAs by Dicer-2 (Dcr-2) and a dsRNA-binding protein (dsRBP) cofactor called Loquacious (Loqs). The siRNAs are then loaded onto Argonaute-2 (Ago2) protein by the action of Dcr-2 with another dsRBP cofactor called R2D2. Loaded Ago2 executes the destruction of target RNAs that have sequence complementarity to the siRNA. Dcr-2, R2D2, and Ago2 have also been shown to be required for innate antiviral defense in Drosophila. However, the biogenesis of virus-derived siRNAs (vsiRNAs) and their targets in virus-infected cells remain unclear. Here, we analyzed the antiviral response in Drosophila by monitoring the replication of different RNA viruses and deep sequencing of small RNAs in infected animals. We show that vsiRNAs are generated by Dcr-2 processing of dsRNA formed during viral genome replication and transcription. These vsiRNAs then directly target viral transcripts but not genomes, to inhibit viral replication. The biogenesis of vsiRNAs was virtually independent of Loqs and R2D2. R2D2, however, was essential for sorting and loading of vsiRNAs onto Ago2 and effective silencing of viral RNA expression. Loqs was completely dispensable for silencing of viruses in contrast to its role in silencing of endogenous targets. Our results suggest the existence of a specific siRNA pathway triggered by viral infection independent of conserved dsRBP cofactors and separate from the endogenous pathway. Inhibition of virus replication resulting from direct injection of viral RNA into Drosophila embryos was also not dependent on Loqs, suggesting the distinction of the two pathways is not related to the mode of entry but recognition of intrinsic features of viral RNA or its mode of replication. We speculate that this unique framework might be necessary for a prompt and efficient antiviral response
2012-03-16 | GSE36449 | GEO
Project description:In Drosophila, the siRNA pathway is initiated when exogenous or endogenous double stranded RNA (dsRNA) is processed into siRNAs by Dicer-2 (Dcr-2) and a dsRNA-binding protein (dsRBP) cofactor called Loquacious (Loqs). The siRNAs are then loaded onto Argonaute-2 (Ago2) protein by the action of Dcr-2 with another dsRBP cofactor called R2D2. Loaded Ago2 executes the destruction of target RNAs that have sequence complementarity to the siRNA. Dcr-2, R2D2, and Ago2 have also been shown to be required for innate antiviral defense in Drosophila. However, the biogenesis of virus-derived siRNAs (vsiRNAs) and their targets in virus-infected cells remain unclear. Here, we analyzed the antiviral response in Drosophila by monitoring the replication of different RNA viruses and deep sequencing of small RNAs in infected animals. We show that vsiRNAs are generated by Dcr-2 processing of dsRNA formed during viral genome replication and transcription. These vsiRNAs then directly target viral transcripts but not genomes, to inhibit viral replication. The biogenesis of vsiRNAs was virtually independent of Loqs and R2D2. R2D2, however, was essential for sorting and loading of vsiRNAs onto Ago2 and effective silencing of viral RNA expression. Loqs was completely dispensable for silencing of viruses in contrast to its role in silencing of endogenous targets. Our results suggest the existence of a specific siRNA pathway triggered by viral infection independent of conserved dsRBP cofactors and separate from the endogenous pathway. Inhibition of virus replication resulting from direct injection of viral RNA into Drosophila embryos was also not dependent on Loqs, suggesting the distinction of the two pathways is not related to the mode of entry but recognition of intrinsic features of viral RNA or its mode of replication. We speculate that this unique framework might be necessary for a prompt and efficient antiviral response We analyzed the small RNA reponse to viral infection by deep sequencing of small RNA libraries from wild type and RNAi mutant adult flies infected with Sindbis birus and Vesicular Stomatatis virus.
2012-03-16 | E-GEOD-36449 | biostudies-arrayexpress
Project description:Identifying cleaved and noncleaved targets of small interfering RNAs and microRNAs in mammalian cells by SpyCLIP
| PRJNA607231 | ENA
Project description:Among the four Argonaute family members in mammals, only AGO2 protein retains endonuclease activity, and facilitates cleavage of target RNAs base-pairing with highly complementary guide RNAs. Despite the deeply conserved catalytic activity, only a small number of targets have been reported to extensively base pair with cognate miRNAs to be cleaved by AGO2. Here, we analyzed AGO2-bound RNAs by CrossLinking ImmunoPrecipitation (CLIP) of genetically modified cells that express epitope-tagged AGO2 from the native genomic locus. We found that HMGA2 mRNA is cleaved by AGO2 loaded with let-7 and miR-21. In contrast to the generally accepted notion, the base-pairing from the seed region to the cleavage site, rather than perfect or near perfect complementarity, was required for cleavage of the target mRNA in cells. Non-templated addition of nucleotides at the 3’ end of the cleaved RNA was observed, further supporting the AGO2-mediated cleavage. Based on the observation that the limited complementarity is the minimum requirement for cleavage, we found that AGO2-mediated cleavage of targets is more common than previously thought. Our result may explain the vital role of endonuclease activity in controlling miRNA-mediated gene regulation.
2017-10-05 | GSE93644 | GEO
Project description:The advent of high-throughput sequencing has led to an explosion of studies into the diversity, expression, processing, and lifespan of RNAs. Recently, three different high-throughput sequencing-based methods have been developed to specifically study RNAs that are in the process of being degraded. All three methods—genome-wide mapping of uncapped and cleaved transcripts (GMUCT), parallel analysis of RNA ends (PARE), and degradome sequencing—take advantage of the fact that Illumina sequencing libraries use T4 RNA ligase 1 to ligate an adapter to the 5’ end of RNAs that have a free 5’-monophosphate. This condition for T4 RNA ligase 1 substrates means that mature mRNAs are not substrates of the enzyme because they have a 5’-cap. As a result, these sequencing libraries are specifically made up of clones of decapped or degrading mRNAs and the 3’ fragment of cleaved miRNA and siRNA targets. In this paper, we present a massively streamlined protocol for GMUCT that takes 2-3 days and can be initiated with as little as 5 µg of starting total RNA and involves only one gel size-selection step. We show that the results are similar to libraries made using the previous GMUCT protocol and PARE.
2014-03-08 | GSE47121 | GEO
Project description:The advent of high-throughput sequencing has led to an explosion of studies into the diversity, expression, processing, and lifespan of RNAs. Recently, three different high-throughput sequencing-based methods have been developed to specifically study RNAs that are in the process of being degraded. All three methods—genome-wide mapping of uncapped and cleaved transcripts (GMUCT), parallel analysis of RNA ends (PARE), and degradome sequencing—take advantage of the fact that Illumina sequencing libraries use T4 RNA ligase 1 to ligate an adapter to the 5’ end of RNAs that have a free 5’-monophosphate. This condition for T4 RNA ligase 1 substrates means that mature mRNAs are not substrates of the enzyme because they have a 5’-cap. As a result, these sequencing libraries are specifically made up of clones of decapped or degrading mRNAs and the 3’ fragment of cleaved miRNA and siRNA targets. In this paper, we present a massively streamlined protocol for GMUCT that takes 2-3 days and can be initiated with as little as 5 µg of starting total RNA and involves only one gel size-selection step. We show that the results are similar to libraries made using the previous GMUCT protocol and PARE. GMUCT libraries were made from flower buds of the Arabidopsis thaliana accession Columbia (Col-0) and three human cell lines—the cervical cancer cell line HeLa, human embryonic kidney 293 T (HEK293T) cell line, and the human chronic myelogenous leukaemia cell line K562—two replicates of each. Matched mRNA-seq libraries were made for each Col-0 GMUCT replicate. These libraries were sequenced on the Illumina HiSeq 2000 and the reads were trimmed to remove the adapter sequences (TGGAATTCTCGGGTGCCAAGGAACTCCAGTCA). The abundance of each unique read was determined, and unique reads were mapped to the Arabidopsis and human genomes, respectively.
2014-03-08 | E-GEOD-47121 | biostudies-arrayexpress
Project description:RNA interference (RNAi) is an evolutionarily conserved phenomenon of post-transcriptional gene silencing mediated by small interfering RNAs (siRNAs) generated from short hairpin RNAs (shRNAs) by Dicer cleavage. Here, we report that siRNA precursors can be divided into two categories with different processing mechanisms and silencing activities that are dependent on stem loop length. We designed an alternative siRNA precursor for triggering RNAi named single-stranded Argonaute2 (Ago2)-processed interfering RNA (saiRNA). saiRNA is composed of a 16-18 bp stem and a loop complementary to the target transcript. The introduction of a self-cleavage ribozyme derived from hepatitis delta virus (HDV) to the 3’ end of the saiRNA dramatically improved its silencing activity. Unlike classical shRNA, the strand-specific cleavage of saiRNA by Ago2 during its processing not only eliminated the passenger strand but also avoided the association of mature siRNA with non-nucleolytic Ago proteins, thereby further reducing the risk of off-target effects. Additionally, saiRNA exhibited less competition with the biogenesis of endogenous miRNAs. Therefore, HDV ribozyme-enhanced saiRNA provides a reliable tool for RNAi applications.
2015-06-01 | GSE68631 | GEO
Project description:To investigate the relevance and the impact of the cleaved FBLN5 variant on fibroblastM-bM-^@M-^Ys physiology, we have employed whole genome microarrays. Human neonatal dermal fibroblasts from three different donors were seeded in duplicates on plates pre-coated with FBLN5, cleaved FBLN5 or heat denatured BSA as a control. After cultivation for 24 h, RNA was isolated and microarrays were performed. Statistical analysis of microarrays resulted in 367 genes significantly differentially expressed in cells cultured on a FBLN5 matrix and 525 genes differentially expressed in cells cultured on a cleaved FBLN5 matrix compared to control (adjusted p-value <0.05). To further validate these gene expression changes identified by microarray analysis 10 randomly choosen genes were reanalyzed by qRT-PCR (quantitative real time polymerase chain reaction). In nine cases the fold changes measured by qRT-PCR were comparable with those measured by microarray analysis, revealing reproducibility and validity of analysis. Fibulin-5 and cleaved FBLN5 contributed to changes in expression pattern of human neonatal dermal fibroblasts after cultivation for 24 h. Three different donors were used in technical duplicates.
2014-07-20 | E-GEOD-58635 | biostudies-arrayexpress