Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing

ABSTRACT: This SuperSeries is composed of the SubSeries listed below.

ORGANISM(S): Arabidopsis thaliana

PROVIDER: GSE14696 | GEO | 2009/06/03

SECONDARY ACCESSION(S): PRJNA112327

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Similar Datasets

Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing

Project description:This SuperSeries is composed of the following subset Series: GSE14694: Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility) GSE14695: Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (standards) Refer to individual Series

2009-06-02 | E-GEOD-14696 | biostudies-arrayexpress

Computational and analytical framework for small RNA profiling by high-throughput sequencing.

Project description: Not available

| S-EPMC2673065 | biostudies-literature

Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility)

Project description:The purpose of this work was to describe a computational and analytical methodology for profiling small RNA by high-throughput sequencing. The datasets here were used to assess the reproducibility of small RNA datasets produced using Illumina sequencing-by-synthesis technology (SBS). We analyzed the reproducibility of small RNA SBS datasets by comparing libraries generated for biological replicates (rep1 and rep2) and technical replicates (rep2 and rep3).

2009-06-02 | E-GEOD-14694 | biostudies-arrayexpress

Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (standards)

Project description:The purpose of this work was to describe a computational and analytical methodology for profiling small RNA by high-throughput sequencing. The datasets here were used to develop synthetic oligoribonucleotides as spike-in standards. We assessed the use of synthetic oligoribonucleotide standards as spike-in controls. These standards can be used to set an objective standard against which to compare samples. Standards were added to the total RNA (100 ug) in the following amounts: Std2 (TATATGCAAGTCCGGCCATAC) 0.01 pmol, Std3 (TAGCTAACGCATATCCGCATC) 0.1 pmol, Std6 (TGAAGCTGACATCGGTCATCC) 1.0 pmol.

2009-06-02 | E-GEOD-14695 | biostudies-arrayexpress

Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (standards)

2009-06-03 | GSE14695 | GEO

Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility)

2009-06-03 | GSE14694 | GEO

High-throughput sequencing of small RNAs: Caenorhabditis elegans

Project description:This SuperSeries is composed of the SubSeries listed below.

2008-06-16 | GSE11738 | GEO

Expression profiling by high throughput sequencing of NDP52

Project description:This SuperSeries is composed of the SubSeries listed below.

2021-11-17 | GSE188567 | GEO

Small noncoding RNA discovery and profiling with sRNAtools based on high-throughput sequencing.