Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

LiBis: An ultrasensitive alignment method for low-input bisulfite sequencing

ABSTRACT: LiBis is a novel method for low-input WGBS data alignment. By dynamically clipping initially unmapped reads and remapping clipped fragments, we judiciously rescued those reads and uniquely aligned them to the genome. By substantially increasing the mapping ratio by up to 88%, LiBis improves the number of informative CpGs and the precision to quantify the methylation status of individual CpG sites. The high sensitivity and cost effectiveness afforded by LiBis for low-input samples will allow the discovery of genetic and epigenetic features suitable for downstream analysis and biomarker identification using liquid biopsy.

ORGANISM(S): Homo sapiens

PROVIDER: GSE147454 | GEO | 2022/09/05

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Similar Datasets

Annual Removal of Aboveground Plant Biomass Alters Soil Microbial Responses to Warming

Project description:Clipping (i.e., harvesting aboveground plant biomass) is common in agriculture and for bioenergy production. However, microbial responses to clipping in the context of climate warming are poorly understood. We investigated the interactive effects of grassland warming and clipping on soil properties, plant and microbial communities, in particular microbial functional genes. Clipping alone did not change the plant biomass production, but warming and clipping combined increased the C4 peak biomass by 47% and belowground net primary production by 110%. Clipping alone and in combination with warming decreased the soil carbon input from litter by 81% and 75%, respectively. With less carbon input, the abundances of genes involved in degrading relatively recalcitrant carbon increased by 38-137% in response to either clipping or the combined treatment, which could weaken the long-term soil carbon stability and trigger a positive feedback to warming. Clipping alone also increased the abundance of genes for nitrogen fixation, mineralization and denitrification by 32-39%. The potentially stimulated nitrogen fixation could help compensate for the 20% decline in soil ammonium caused by clipping alone, and contribute to unchanged plant biomass. Moreover, clipping tended to interact antagonistically with warming, especially on nitrogen cycling genes, demonstrating that single factor studies cannot predict multifactorial changes. These results revealed that clipping alone or in combination with warming altered soil and plant properties, as well as the abundance and structure of soil microbial functional genes. The aboveground biomass removal for biofuel production needs to be re-considered as the long-term soil carbon stability may be weakened.

2016-09-27 | GSE86527 | GEO

renal damage in 24w2k1c v cont24w

Project description:The experiment was designed to study the effects of blood pressure on gene expressions in the kidney cortex. Non-clipped kidney cortex was harvested from eight 2k1c rats and eight sham rats after 4 and 24 weeks of clipping. The 2k1c is the experimental group which underwent a two kidney, one clip (2k1c) operation (renal artery stenosis), wheras the sham group serves as a control where no stenosis were performed.

2014-11-11 | E-MTAB-1449 | biostudies-arrayexpress

Intestinal Differentiation Involves Cleavage of Histone H3 NTerminal Tails by Multiple Proteases

Project description:The proteolytic cleavage of histone tails, also termed histone clipping, has been described as a mechanism for permanent removal of post-translational modifications (PTMs) from histone proteins. Such activity has been ascribed to ensure regulatory function in key cellular processes such as differentiation, senescence and transcriptional control for which different histone-specific proteases has been described. However, all these studies were exclusively performed using cell lines cultured in vitro and no clear evidences that histone clipping is regulated in vivo has been reported. Here we show that histone H3 N-terminal tails undergo extensive cleavage in the differentiated cells of the villi fraction of the mouse intestinal epithelium and we investigate histone PTM changes in full-length compared with clipped histone H3.

2021-01-11 | PXD022171 | Pride

PAtCh-Cap: input strategy for improving analysis of ChIP-exo data sets and beyond

Project description:Recently, a number of advances have been implemented into the core ChIP-seq (chromatin immunoprecipitation coupled with next-generation sequencing) methodology to streamline the process, reduce costs or improve data resolution. Several of these emerging ChIP-based methods perform additional chemical steps on bead-bound immunoprecipitated chromatin, posing a challenge for generating similarly treated input controls required for artifact removal during bioinformatics analyses. Here we present a versatile method for producing technique-specific input controls for ChIP-based methods that utilize additional bead-bound processing steps. This reported method, termed protein attached chromatin capture (PAtCh-Cap), relies on the non-specific capture of chromatin-bound proteins via their carboxylate groups, leaving the DNA accessible for subsequent chemical treatments in parallel with chromatin separately immunoprecipitated for the target protein. Application of this input strategy not only significantly enhanced artifact removal from ChIP-exo data, increasing confidence in peak identification and allowing for de novo motif searching, but also afforded discovery of a novel CTCF binding motif.

2016-08-24 | GSE79563 | GEO

Baiting out a full length sequence from unmapped RNA-seq data

Project description:Usually, unmapped reads have been considered as useless and been trashed or ignored. Here, we develop a strategy to mining the full length sequence by unmapped reads combining with specific reverse transcription primers design and high throughput sequencing. In this study, we salvage 36 unmapped reads from standard RNA-Seq data(GSM3188619) and randomly select one 149 bp read as a model(CTGGTGCCATAATTCAGGGAACTGTGTTCTTGATGTACTATCTGAGACATTTGTGCTTCCCCCCATCCAGCTATCAGGCTGTTAGGCAATGCACTTCTAGGAATTAGAATTCTATAAGGAATCTCATGCTGGAAGAACAAAAAGACCCA ). Specific reverse transcription primers(5' end:CTGGTGCCATAATTCAGGGA, 3' end:GGATCTTCACGTAACGGATTGT) are designed to amplify its both ends, followed by next generation sequencing. Then we use a statistical model base on power law distribution to estimate its integrality and significance. Further, we validate it by Sanger sequencing. The result shows that the full length is 1,556 bp, with InDel mutation in microsatellite structure. This would be a useful strategy to extract the sequences information from the unmapped RNA-seq data.

2021-04-22 | GSE172487 | GEO

Retinal input instructs alignment of visual topographic maps.

Project description: Not available

| S-EPMC2814139 | biostudies-literature

low input proteomics method DROPPS

Project description:Files associated with the development, testing, and application of the low-input proteomics method DROPPS

| MSV000092829 | MassIVE

Robust spindle alignment in Drosophila neuroblasts by ultrasensitive activation of pins.

Project description: Not available

| S-EPMC3161515 | biostudies-literature

RNA-seq of H1N1 infected monocyte-derived dendritic cells (MoDC), stimulated with single-stranded oligonucleotides (ssON) and/or Poly I:C.

Project description:Evaluation of modulation of the innate immune response during H1N1 infection. The modulatory effect of Single-stranded oligonucleotides (ssON) on monocyte-derived dendritic cells (MoDCs) are evaluated. RNAseq data are used to study the effect on the transcriptome of MoDCs, during infection with simultaneous addition of ssON. Further mechanistic information are added via RNAseq data on poly I:C stimulated MoDCs (Toll-Like Receptor 3 agonist). Control samples are included to perform differential expression analysis. Provided are the fastq files, obtained in the following manner: The RNA sequencing was performed with the TruSeq RiboZero kit from Illumina, 25 M reads per sample and 2x125bp. Read quality were assessed using FastQC (Version 0.11.5) Trim Galore (Version 0.3.6) was used for adapter removal and quality trimming with a quality threshold of 20 on the Phred scale. Count files was created out of the trimmed fastq by mapping high-quality reads to Homo sapiens UCSC hg38 (GRCh38.77) reference genome using STAR aligner (version 2.5) with default values and the parameter out Reads Unmapped set to Fastx in order to extract the unmapped reads. After STAR alignment, the count data for the aligned reads were generated with HTSeq-count (version 0.6.1). The-m parameter was set to union.

2019-05-03 | E-MTAB-7803 | biostudies-arrayexpress

Identification of polyA sites in Drosophila melanogaster

Project description:The 3' ends of most Drosophila melanogaster genes are poorly annotated or are determined by only a single EST or cDNA clone. To enhance the annotation of poly(A) site use in Drosophila, we performed deep sequencing on RNA isolated from 29 dissected tissues using an approach designed to enrich for poly(A) spanning reads. From these experiments, we identified 1.4 million poly(A) spanning reads leading to the identification of many new poly(A) sites and the identification of many tissue-specific poly(A) sites. For data usage terms and conditions, please refer to http://www.genome.gov/27528022 and http://www.genome.gov/Pages/Research/ENCODE/ENCODEDataReleasePolicyFinal2008.pdf RNA from 29 dissected Drosophila melanogaster tissues (in duplicate) were used to prepare polyA enriched RNA-Seq libraries. Briefly, total RNA was poly(A) selected, fragmented, and ligated to 5' and 3' RNA linkers. These libraries were amplified using Illumina paired-end primers, and subsequently reamplified using a 3' primer complementary to the 3' adapter but containing 6 Ts at the 3' end. The libraries were also multiplexed and up to 12 samples mixed per lane and sequenced on an Illumina GAIIx using paired-end 76 bp reads, or an illumina HiSeq 2000 using paired-end 100 bp reads. All reads were mapped to the Drosophila melanogaster genome to identify unmapped reads. Unmapped reads containing at least 10 A residues at the 3' end were identified, the terminal A residues trimmed, realigned to the genome to identify uniquely mapped reads. Such reads were identified as polyA spanning reads

2011-11-23 | E-GEOD-33905 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data