Dataset Information

The loss of CARMN regulates vascular smooth muscle cell phenotype and accelerates the development of atherosclerosis in mice.

ABSTRACT: We investigated the function of CARMN lncRNA, located immediately upstream of the miRNAs miR-143 and miR-145, as critical regulator of vSMC phenotypes in vitro and the consequence of its loss during the development of atherosclerosis in vivo. We hypothesized that loss of CARMN is a primary event controlling the functional switch towards pro-atherogenic vSMC phenotypes and accelerates the development of the plaques in vivo.

ORGANISM(S): Homo sapiens

PROVIDER: GSE158972 | GEO | 2021/04/06

REPOSITORIES: GEO

ACCESS DATA

Similar Datasets

Project description:Purpose: Homeostatic control of vascular smooth muscle cell (VSMC) differentiation is critical for contractile activity and regulation of blood flow. Recently, we reported that pre-contracted blood vessels are relaxed and the phenotype of VSMC is regulated from a synthetic to contractile state by glucose-6-phosphate dehydrogenase (G6PD) inhibition. In the current study, we investigated whether the increase in the expression of VSMC contractile proteins by inhibition and knockdown of G6PD is mediated through a protein kinase G (PKG)-dependent pathway and whether it regulates blood pressure Methods: Coronary arteries (LAD) isolated from bovine heart mRNA profiles of 12-16 week old wild type (WT) and G6PD-deficient mice were generated by deep sequencing, in triplicate, using Illumina HiSeq 2500. The sequence reads that passed quality filters (Trimmomatic-0.32) were analyzed at the transcript isoform level using STAR_2.4.2a for mapping to reference GRCm38.p4 + Gencode-M6 Annotation and processed with Cufflinks-2.0.2. miR analysis was performed by quantitative RT-PCR (qRT-PCR) for validation using miR-specific TaqMan miR assays (Applied Biosystems, Foster City, CA). Quantitative PCR was performed in triplicate using TaqMan Universal PCR Master mix. Standard curves were made for each miR using synthetic miR oligonucleotides (IDT, Coralville, IA) with the following sequence: Rno-miR-145: GUCCAGUUUUCCCAGGAAUCCCU, Rno-miR-1: UGGAAUGUAAAGAAGUGUGUAU, Rno-miR-143: UGAGAUGAAGCACUGUAGCUC, Rno-miR-133a: UUUGGUCCCCUUCAACCAGCUG Results: We found that the expression of VSMC-restricted contractile proteins, myocardin (MYOCD), and miR-1 and miR-143 are increased by G6PD inhibition or knockdown. Importantly, RNA-sequence analysis of aortic tissue from G6PD-deficient mice revealed uniform increases in VSMC-restricted genes, particularly those regulated by the MYOCD-serum response factor (SRF) switch. Conversely, expression of Krüppel-like factor 4 (KLF4) is decreased by G6PD inhibition. Interestingly, the G6PD inhibition-induced expression of miR-1 and contractile proteins was blocked by Rp-β-phenyl-1,N2-etheno-8-bromo-guanosine-3’,5’-cyclic monophosphorothioate, a PKG inhibitor. On the other hand, MYOCD and miR-143 levels are increased by G6PD inhibition through a PKG-independent manner. Furthermore, blood pressure was lower in the G6PD-deficient as compared to wild-type mice Conclusions: Therefore, our results suggest that the expression of VSMC contractile proteins induced by G6PD inhibition occurs via PKG1-dependent and –independent pathways

Dataset Information

The loss of CARMN regulates vascular smooth muscle cell phenotype and accelerates the development of atherosclerosis in mice.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure