DDX3X Loss is Associated with Aggressive Phenotypes in Non-Hodgkin’s Lymphomas
Ontology highlight
ABSTRACT:
ORGANISM(S): Homo sapiens
PROVIDER: GSE163817 | GEO | 2020/12/25
REPOSITORIES: GEO
Similar Datasets
Project description:DDX3X Loss is Associated with Aggressive Phenotypes in Non-Hodgkin’s Lymphomas
| PRJNA687675 | ENA
Project description:DDX3X is an ATP-dependent RNA helicase. Missense mutations in DDX3X gene are known to occur in WNT, SHH subgroup medulloblastomas. The role of DDX3X in medulloblastoma biology was studied by downregulating its expression in a SHH subgroup Daoy medulloblastoma cell line. DDX3X knockdown resulted in considerable reduction in proliferation, clonogenic potential and anchorage-independent growth of the medulloblastoma cells. Transcriptome analysis was performed to delineate the molecular mechanism underlying reduction in the malignant potential of the medulloblastoma cells upon DDX3X knockdown. Exogenous expression of three DDX3X missense mutants in the DDX3X knockdown cells could restore the malignant potential of the medulloblastoma cells.
2023-03-31 | GSE201967 | GEO
Project description:Paralog dependency analysis of the DDX3X/DDX3Y genes through RNA-seq. Three types of KNS-42 cell lines are used in this experiment: one parental, one with a DDX3X over-expression (codon optimized) and one with DDX3Y over-expression (codon optimized). Targeting of the DDX3X gene is performed with guide RNAs 395 (TGGTACATGCGTATCCTTCA). The negative control is targeting AAVS1/PPP1R12C (AAVS1, GGGGCCACTAGGGACAGGAT). Samples were processed at 7 days after transduction. 3 independent repeats of the experiment were performed.
2022-04-06 | GSE190507 | GEO
Project description:Whole-genome sequencing recently identified recurrent missense mutations in the RNA helicase DDX3X in pediatric medulloblastoma (MB) and other tumors. The normal function of DDX3X is poorly understood, and the consequences of its cancer-associated mutations have not been explored. Here we used genomic, biochemical, cell biological, and animal modeling approaches to investigate normal DDX3X function and the impact of cancer-associated DDX3X mutations. Cross-linking immunoprecipitation–high-throughput sequencing (CLIPseq) analyses revealed that DDX3X binds primarily to ~1000 mature mRNA targets at binding sites spanning the full mRNA length; their enrichment in the coding regions suggests that DDX3X plays a role in translational elongation. The association of wild-type DDX3X with polysomes is consistent with this observation. Cancer-associated mutations result in loss of DDX3X from polysomes and accumulation of mutant DDX3X in stress granules (cytoplasmic accumulations of translationally arrested mRNAs). Mutation-dependent redistribution of DDX3X to stress granules is also observed in a Drosophila model system and in MB tumor cells from patients carrying DDX3X mutations. Importantly, mRNAs targeted by DDX3X are enriched in translation factors, suggesting that DDX3X regulates translation both directly and indirectly. Indeed, depletion of DDX3X by RNAi or over-expression of mutant DDX3X significantly impairs global protein synthesis. Ribosome profiling confirmed this observation and showed a 5’ bias in ribosomal occupancy, further confirming the role of DDX3X in translational elongation. Together, our data show that DDX3X is a key regulator of translation and that this function is impaired by cancer-associated mutations. Finally, we found that medulloblastoma-related mutant DDX3X can efficiently bind the wild-type form suggesting that mutant DDX3X could exert a dominant negative effect in vivo.
2016-05-20 | GSE59095 | GEO
Project description:DDX3X is frequently mutated in the WNT and SHH subtypes of medulloblastoma Ð the commonest malignant childhood brain tumor. But whether DDX3X functions as a medulloblastoma oncogene or tumor suppressor gene is not known. Here we show that Ddx3x regulates hindbrain patterning and development by controlling Hox gene expression and cell stress signaling. In mice predisposed to Wnt or Shh-medulloblastoma Ddx3x sensed oncogenic stress and suppressed tumor formation. WNT and SHH-medulloblastomas normally arise only in the lower and upper rhombic lips respectively. Deletion of Ddx3x relived this lineage restriction enabling both medulloblastoma subtypes to arise in either germinal zone. Thus DDX3X is a medulloblastoma tumor suppressor that regulates hindbrain development and restricts the competence of cell lineages to form medulloblastoma subtypes.
2020-03-19 | GSE147069 | GEO
Project description:DDX3X is frequently mutated in the WNT and SHH subtypes of medulloblastoma Ð the commonest malignant childhood brain tumor. But whether DDX3X functions as a medulloblastoma oncogene or tumor suppressor gene is not known. Here we show that Ddx3x regulates hindbrain patterning and development by controlling Hox gene expression and cell stress signaling. In mice predisposed to Wnt or Shh-medulloblastoma Ddx3x sensed oncogenic stress and suppressed tumor formation. WNT and SHH-medulloblastomas normally arise only in the lower and upper rhombic lips respectively. Deletion of Ddx3x relived this lineage restriction enabling both medulloblastoma subtypes to arise in either germinal zone. Thus DDX3X is a medulloblastoma tumor suppressor that regulates hindbrain development and restricts the competence of cell lineages to form medulloblastoma subtypes.
2020-03-19 | GSE147178 | GEO
Project description:Whole-genome sequencing recently identified recurrent missense mutations in the RNA helicase DDX3X in pediatric medulloblastoma (MB) and other tumors. The normal function of DDX3X is poorly understood, and the consequences of its cancer-associated mutations have not been explored. Here we used genomic, biochemical, cell biological, and animal modeling approaches to investigate normal DDX3X function and the impact of cancer-associated DDX3X mutations. Cross-linking immunoprecipitation–high-throughput sequencing (CLIPseq) analyses revealed that DDX3X binds primarily to ~1000 mature mRNA targets at binding sites spanning the full mRNA length; their enrichment in the coding regions suggests that DDX3X plays a role in translational elongation. The association of wild-type DDX3X with polysomes is consistent with this observation. Cancer-associated mutations result in loss of DDX3X from polysomes and accumulation of mutant DDX3X in stress granules (cytoplasmic accumulations of translationally arrested mRNAs). Mutation-dependent redistribution of DDX3X to stress granules is also observed in a Drosophila model system and in MB tumor cells from patients carrying DDX3X mutations. Importantly, mRNAs targeted by DDX3X are enriched in translation factors, suggesting that DDX3X regulates translation both directly and indirectly. Indeed, depletion of DDX3X by RNAi or over-expression of mutant DDX3X significantly impairs global protein synthesis. Ribosome profiling confirmed this observation and showed a 5’ bias in ribosomal occupancy, further confirming the role of DDX3X in translational elongation. Together, our data show that DDX3X is a key regulator of translation and that this function is impaired by cancer-associated mutations. Finally, we found that medulloblastoma-related mutant DDX3X can efficiently bind the wild-type form suggesting that mutant DDX3X could exert a dominant negative effect in vivo.
2016-05-20 | GSE59094 | GEO
Project description:Whole-genome sequencing recently identified recurrent missense mutations in the RNA helicase DDX3X in pediatric medulloblastoma (MB) and other tumors. The normal function of DDX3X is poorly understood, and the consequences of its cancer-associated mutations have not been explored. Here we used genomic, biochemical, cell biological, and animal modeling approaches to investigate normal DDX3X function and the impact of cancer-associated DDX3X mutations. Cross-linking immunoprecipitation–high-throughput sequencing (CLIPseq) analyses revealed that DDX3X binds primarily to ~1000 mature mRNA targets at binding sites spanning the full mRNA length; their enrichment in the coding regions suggests that DDX3X plays a role in translational elongation. The association of wild-type DDX3X with polysomes is consistent with this observation. Cancer-associated mutations result in loss of DDX3X from polysomes and accumulation of mutant DDX3X in stress granules (cytoplasmic accumulations of translationally arrested mRNAs). Mutation-dependent redistribution of DDX3X to stress granules is also observed in a Drosophila model system and in MB tumor cells from patients carrying DDX3X mutations. Importantly, mRNAs targeted by DDX3X are enriched in translation factors, suggesting that DDX3X regulates translation both directly and indirectly. Indeed, depletion of DDX3X by RNAi or over-expression of mutant DDX3X significantly impairs global protein synthesis. Ribosome profiling confirmed this observation and showed a 5’ bias in ribosomal occupancy, further confirming the role of DDX3X in translational elongation. Together, our data show that DDX3X is a key regulator of translation and that this function is impaired by cancer-associated mutations. Finally, we found that medulloblastoma-related mutant DDX3X can efficiently bind the wild-type form suggesting that mutant DDX3X could exert a dominant negative effect in vivo.
2016-05-20 | GSE59093 | GEO
Project description:Sex differences are pervasive in human health and disease. One of the major keys to sex-biased differences lies in the sex chromosomes, which encode a group of sex-specific protein homologs. Although the functions of the X chromosome proteins are well appreciated, how they compare with their Y chromosome homologs remains elusive. One pair of sex chromosome-encoded proteins are the RNA helicases DDX3X and DDX3Y. DDX3X and DDX3Y can both form stress granules (SGs) under different types of stress. SGs are composed of a stable core structure, they are surrounded by a dynamic shell with assembly, disassembly, and transitions of proteins and RNA between the core and shell. Different SGs have distinct proteins and RNA constituents, which raises the possibility that different SGs might perform different biological functions. Previously, we performed APEX-seq to explore the RNA compositions in DDX3X and DDX3Y SGs, however, the difference between the mRNA partner of DDX3X and DDX3Y without stress treatment is still uncharted. Therefore, we applied the APEX-seq to cytosome diffused DDX3X and DDX3Y.
2022-06-01 | GSE193783 | GEO
Project description:To identify DDX3X-dependent translation targets in the developing mouse cortex, we used E11.5 cortices from both sexes of wildtype and conditional Ddx3x knockout mice (driven by Emx1-Cre). We performed RNAseq and Riboseq on these samples in parallel.
2022-05-18 | GSE203078 | GEO