Dataset Information

Expression data of sham and p21-overexpressed MLE-12 cells

ABSTRACT: We report that p21 expression was increased in the alveolar epithelial type 2 cells (AEC2s) in a time dependent manner following multiple bleomycin induced pulmonary fibrosis (PF). The AEC2s with the elevated expression of p21 exhibited cell senescence and lost the ability of self-renewal and differentiation. Evaluation of mRNA profiles in sham and p21-adenovirus treated MLE-12 cells is helpful to analyze the changes of lung alveolar epithelial cells after p21 deposition.

ORGANISM(S): Mus musculus

PROVIDER: GSE166198 | GEO | 2022/02/01

REPOSITORIES: GEO

ACCESS DATA

Similar Datasets

Project description:The successful repair and renewal of alveolar epithelial cells are critical steps in prohibiting the accumulation of myofibroblasts and deposition of extracellular matrix in pulmonary fibrogenesis. MicroRNAs (miRNAs) are multi-focal regulators involved in the lung repair process. The contribution of miRNAs to epithelial maintenance and renewal is incompletely understood. We provide evidence that miR-29c on type 2 alveolar epithelial cells (AEC2s) are important for inhibiting AEC2 apoptosis and promoting AEC2 renewal, thus restraining the degree of fibrosis. MiR-29c was lower in AEC2s from lungs of idiopathic pulmonary fibrosis (IPF) individuals than from healthy lungs. Epithelial cells overexpressing miR-29c showed higher proliferative rate and viability. MiR-29c was protective against epithelial apoptosis by targeting Foxo3a. Both overexpression of miR-29c conventionally and AEC2s specifically led to less fibrosis and better recovery. Furthermore, loss of miR-29c in AEC2s resulted in higher apoptosis and reduced epithelial renewal than in control animals. Thus, miR-29c maintains epithelial integrity and promotes recovery from lung injury, attenuating lung fibrosis in mice. The miR-29c overexpression mouse epithelial cell line was generated based on the strategy described before38. MiR-29c lentiviral construct was generated as follows: a region of 131 nucleotides containing pre-mmu-miR-29c was amplified from mouse genomic DNA by using the following primers: 5’ MIR-29c: GTCGGTTAACATCTCTTACACAGG and 3’ MIR-29c: ACACCTCGAGGATCCTGAGGCTGGT. They were then cloned into the HpaI/XhoI sites of a pSico vector62, named pSico-miR-29c. Viral particles were produced by calcium phosphate–mediated transfection into 293T cells as described63. Lentiviral supernatants were collected 48 hours after transfection, passed through a 0.22-μm filter, and used directly to infect MLE 12 cells. GFP-positive cells were sorted 2-3 days after infection and resulted in MLE 12-SicoGFP and MLE 12-miR-29cGFP cells. Recombinant adenoviral stocks expressing Cre recombinase were purchased from the Gene Transfer Vector Core facility of University of Iowa College of Medicine (Iowa City, IA). Infections of GFP-positive cells were performed by using 100 plaque-forming units of virus per cell. Four days after adenovirus infections, the GPF-negative cells were sorted from GFPpos infected with adeno-Cre as Mlesico and Mle29c cells.

Project description:Lung adenocarcinoma is responsible for significant global mortality with limited effective treatments. Although some studies suggest that these tumors arise from alveolar epithelial type 2 cells (AEC2s), there is scant information regarding the early events that might occur in human AEC2s at the inception of oncogenesis. This limitation, is partially due to a lack of human model systems that recapitulate the initiation of oncogenesis in AEC2s. Unfortunately, primary AEC2s from patients are difficult to access in vivo or stably maintain in cell cultures. Hence, we sought to develop an in vitro system to model the early stages of oncogenesis utilizing human induced AEC2s (iAEC2s) generated through the directed differentiation of induced pluripotent stem cells (iPSCs). To this end, we selected a normal human iPSC line we have previously engineered to carry fluorochrome reporters targeted to lung epithelial-specific loci, NKX2-1GFP and SFTPCtdTomato that enable monitoring and purification of alveolar lung epithelial cells. To test the effects of adenocarcinoma oncogene induction in these cells, we targeted a third locus, AAVS1 using gene editing to engineer a doxycycline-inducible cassette encoding mutant KRASG12D, the most commonly found oncogene in lung adenocarcinomas. Successful induction of KRASG12D with doxycycline was demonstrated in both the targeted undifferentiated iPSCs as well as in the iAEC2s derived from these cells. We profiled the downstream effects of KRASG12D induction in iAEC2s, comparing dox vs vehicle exposed cells by cell counting, FACS for NKX2-1GFP/SFTPCtdTomato, RT-qPCR, deep proteomic and phosphoproteomic analyses, and scRNA-sequencing. Through this characterization, we found that induction of KRASG12D robustly activates MAPK signaling resulting in a shift of iAEC2s away from their mature alveolar program towards a distal lung epithelial progenitor phenotype. Successful modeling of lung adenocarcinoma with this model system has a variety of future applications, including testing unknown mechanisms for oncogenesis, discovery of novel biomarkers of disease, or development of new effective treatment methods through drug screening.

Dataset Information

Expression data of sham and p21-overexpressed MLE-12 cells

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure