Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Non-muscle myosin heavy chain 9 maintains intestinal homeostasis by preventing epithelium necroptosis and colitis adenoma formation

ABSTRACT: Non-muscle myosin IIA plays an important role in cell adhesion, cell migration and tissue architecture. We previously showed that low activity of the heavy chain of non-muscle myosin II Myh9 is beneficial to Lgr5+ intestinal stem cell maintenance. However, the function of Myh9 in adult mouse intestinal epithelium is largely unclear. In this study, we used the inducible Villin-creERT2 knockout approach to delete Myh9 in adult mouse intestinal epithelium and observed that homozygous deletion of Myh9 causes colitis-like morphologic changes in intestine, leads to a high sensitivity to dextran sulfate sodium and promotes the colitis related adenomas formation in colon. Myh9 deletion disturbs cell junctions and impairs intestinal lumen barrier integrity, promoting the necroptosis of epithelial cells. Consistently, these changes can be partially rescued by Ripk3 knockout. Our results indicate that Myh9 is required for the maintenance of intestinal epithelium integrity and the prevention of cell necroptosis.

ORGANISM(S): Mus musculus

PROVIDER: GSE169225 | GEO | 2021/03/20

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Similar Datasets

Non-muscle myosin heavy chain 9 maintains intestinal homeostasis by preventing epithelium necroptosis and colitis adenoma formation

Project description:Non-muscle myosin heavy chain 9 maintains intestinal homeostasis by preventing epithelium necroptosis and colitis adenoma formation

| PRJNA715738 | ENA

Myh9 plays essential role in hematopoietic stem/progenitor cells survival and maintenance

Project description:Myosin heavy chain 9 (MYH9) gene encodes a protein named non-muscle heavy chain IIA (NMHC IIA), interacting with actin and participating in various biological processes. Mutations in MYH9 cause an array of autosomal dominant disorders, known as MYH9-related diseases (MYH9-RD). However, the role of MYH9 in normal hematopoiesis remains largely unexplored. By using Mx1-cre Myh9 conditional knockout mice, we established an inducible system to precisely inactivate Myh9 function in hematopoietic cells in vivo. The results showed that deletion of Myh9 led to severe defects in hematopoiesis, characterized by pancytopenia, drastic decreases of hematopoietic stem/progenitor cells (HSPC), and bone marrow failure, causing early lethality in mice. The defect in hematopoiesis caused by Myh9 ablation is cell autonomous. In addition, Myh9 deletion impairs HSPC repopulation capacity and increases apoptosis. RNA sequencing results revealed significant alterations in the expression of genes related to HSC self-renewal and maintenance, while multiple signal pathways were also involved, including genes for HSC and myeloid cell development, intrinsic apoptosis, targets of mTOR signaling, and maturity of hematopoietic cells. Collectively, our findings suggest an essential role for Myh9 in the survival and maintenance of HSPC in normal hematopoiesis.

2022-06-01 | GSE198134 | GEO

The dual lipid desaturase/hydroxylase DEGS2 controls phytoceramide levels necessary to counter intestinal inflammation

Project description:Intestinal immunity is dependent on barrier function to maintain quiescence. The mechanisms for the maintenance of this barrier are not fully understood. Delta 4-desaturase, Sphingolipid 2 (DEGS2) is a lipid desaturase and hydroxylase, which catalyzes the synthesis of ceramide and phytoceramide from dihydroceramide. Using a forward genetic approach, we found and validated a mutation in Degs2 as causative in increasing susceptibility to colitis and altering the phytoceramide balance in the colon. DEGS2 is expressed in the intestinal epithelium, and the colitis phenotype is dependent on the non-hematopoietic compartment of the mouse. In the absence of DEGS2, the colon lacks phytoceramides and accumulates large amounts of the precursor lipid dihydroceramide. In response to DSS induced colitis, colonic epithelial cells in DEGS2-deficient mice had increased cell death and decreased proliferation compared to those in wildtype mice. These findings demonstrate that DEGS2 is needed to maintain epithelial integrity, protect against DSS-induced colitis and maintain lipid balances in vivo.

2023-08-24 | GSE235544 | GEO

Smarcad1 coordinates innate immunity-linked gene expression in the intestinal epithelium [16S Amplicon-seq]

2020-02-05 | GSE127546 | GEO

DNA methylation is required for the control of stem cell differentiation in the small intestine

Project description:The mammalian intestinal epithelium has a unique organization where crypts harboring stem cells produce progenitors and finally clonal populations of differentiated cells. Remarkably, the epithelium is replaced every three to five days throughout adult life. Disrupted maintenance of the intricate balance of proliferation and differentiation leads to loss of epithelial integrity, barrier function, or cancer. There is a tight correlation between epigenetic status of genes and expression changes during differentiation; however, the mechanism of how changes in DNA methylation direct gene expression and the progression from stem cells to their differentiated descendants is unclear. Using conditional gene ablation of the maintenance methyltransferase Dnmt1, we demonstrate that reducing DNA methylation causes intestinal crypt expansion in vivo. Determination of the base-resolution DNA methylome in stem cells and their differentiated descendants shows that DNA methylation is dynamic at enhancers, which are often associated with genes important for both stem cell maintenance and differentiation. We establish that the loss of DNA methylation at intestinal stem cell gene enhancers causes inappropriate gene expression and delayed differentiation.

2014-03-13 | E-MTAB-2350 | biostudies-arrayexpress

Smarcad1 coordinates innate immunity-linked gene expression in the intestinal epithelium [wCO RNA-seq]

Project description:Smarcad1 is one of the most conserved chromatin remodelling factors, from yeast to human, with suggested functions in gene silencing, heterochromatin maintenance and genome stability. However, its role in tissue function is poorly understood. As this factor is highly expressed in the stem- and proliferative zone in the intestinal epithelium, we explored the role of this factor in this tissue. Specific deletion of Smarcad1 in the intestinal epithelium led to colitis resistance in the dextran sodium sulphate colitis model. Intestine tissue-specific deletion of Smarcad1 resulted in notable changes in gene expression in the small intestine, colon and organoids from small intestine. Strikingly, we found an increase of expression of several genes linked to innate immunity. Our study demonstrates that an innate immunity response can be coordinated by a chromatin remodelling factor. It highlights the role of intestinal epithelial cells in the colitis response and we identified candidate members of the gut microbiome that elicit an epithelial Smarcad1-dependent colitis response.

2020-02-05 | GSE127526 | GEO

Ribonucleoprotein immunoprecipitation of myosin proteins and myosin-specific chaperones in fission yeast

Project description:Ribonucleoprotein immunoprecipitation microarray (RIp-chip) study using various myosin proteins and myosin-specific chaperones from the fission Schizosaccaromyces pombe

2010-03-01 | E-TABM-335 | biostudies-arrayexpress

IL-22 Prevents Epithelial Dysfunction During Citrobacter rodentium-induced Infectious Colitis

Project description:IBD is a complex autoimmune disease characterized by dysregulated interactions between host immune responses and microbiome at the intestinal epithelium interface. Here we identified shared protein alterations in intestinal epithelial differentiation and function between IBD and Citrobacter rodentium infected FVB mice. We discovered that prophylactic treatment with the mucosal healing therapy IL-22.Fc in the infected FVB mice reduced disease severity and rescued the mice from lethality. Notably, we observed an emergence of intermediate undifferentiated intestinal epithelial cells upon infection, with disrupted expression of the solute transporter machinery as well as components critical for intestinal barrier integrity. Multi-omics analyses revealed that with IL-22.Fc treatment several disease associated changes were prevented (including disruption of the solute transporter machinery), and proper physiological homeostatic functions of the intestine was restored. Taken together, we unveiled the disease relevance of the C. rodentium induced colitis model to IBD and demonstrated the protective role of the mucosal healing therapy IL-22.Fc in ameliorating the epithelial dysfunction.

2023-10-05 | PXD024688 | Pride

Ribonucleoprotein immunoprecipitation of fission yeast to study myosin proteins and myosin-specific chaperones

Project description:Ribonucleoprotein immunoprecipitation microarray (RIp-chip) study using various myosin proteins and myosin-specific chaperones from the fission Schizosaccaromyces pombe. Two strains were used. In rng3TAP the rng3 protein has been tagged with TAP to allow its detection and immunoprecipitation. The TAP strain expresses the TAP sequence alone (without being attached to an other protein)

2008-12-23 | E-TABM-516 | biostudies-arrayexpress

Transcriptomic Profiling of Myosin 1e WT and KO 4T1 Cell Pools

Project description:Myosin 1e may influnece the metastatic spread of breast cancer cells as determined using the MMT-PyMT mouse model deficient in myo1e, which demonstrated no lung metastases. Therefore, we used CRISPR to knock out Myosin 1e (myo1e) in the 4T1 breast cancer line to study the effect on the propensity to metastasize. The Myosin 1e (Myo1e) WT and KO 4T1 cell pools were generated by Synthego using gRNA sequence 'CUUCUUCAGGUUCUCUACAA'.

2023-12-18 | GSE202685 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data