Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Integration sites sequencing of HIV infection on ZNF417 ZNF587 dKO 293T cells

ABSTRACT: We infected ZNF417 ZNF587 dKO 293T or control 293T with NL4.3 virus for 48 hours. Then genomic DNA was purified from cell lysis with by phenol chloroform. DNA was sheared into 300 bp-500 bp random fragments using Covaris Adaptive Focused Acoustics (Covaris, Woburn, MA). Sheared DNA was ligated with a linker and PCR with primers targeting HIV LTR and linker. PCR products were performed second PCR with Illumina adaptor primers. Libraries were so constructed and sequenced on Novaseq 6000.

ORGANISM(S): Homo sapiens

PROVIDER: GSE174239 | GEO | 2021/12/31

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

ChIP-seq on Znf417 and Znf587 overexpression 293T to verify Znf417 and Znf587 binding capacity at PBS-Lys elements.

Project description:The ChIP-seq experiments using GFP antibody on ZNF417/ZNF587-GFP overexpressing 293T cells revealed that ZNF417/ZNF587 preferred to bind a PBS-Lys-containing HERVs. Further motif calling analysis showed that both ZNF417 and ZNF587 bind to HERVK PBS-resembled motif.

2021-12-01 | GSE156600 | GEO

ChIP-seq on Znf417 and Znf587 overexpression 293T to verify Znf417 and Znf587 binding capacity at PBS-Lys elements.

Project description:ChIP-seq on Znf417 and Znf587 overexpression 293T to verify Znf417 and Znf587 binding capacity at PBS-Lys elements.

| PRJNA658494 | ENA

RNA-seq on ZNF417/587 double KO 293T

Project description:To verify Znf417 and Znf587 knock out whether leads to HERV-K element reactivation, we performed RNA-seq on Znf417/Znf587 double knock out (DKO) 293T cell lines. We did not find any significant changes in HERVK expression.

2021-12-01 | GSE156602 | GEO

RNA-seq of ZNF417/ZNF587 KD or control H1 cells

Project description:RNAseq of human embryonic stem cells depleted for ZNF417 and ZNF587 or control cells

2020-01-24 | GSE144153 | GEO

Genome-wide contacts of rDNA units detected by 4C procedure in human genome [new]

Project description:4C-rDNA procedure was used for analysis of genomic contacts of rDNA units in HEK 293T cells. The primers for PCR amplification were selected upstream from EcoRI site (coordinate 30487 in the sequence with Accession number U13369.1): 5' TTCGCCTACGGATTTCTAGAAAATAA 3' and 5' AAAAGAAGCTCAAGTACATCTAATCTAA 3' (new primers).

2022-12-01 | GSE121363 | GEO

Integration sites sequencing of HIV infection on ZNF417 ZNF587 dKO 293T cells

Project description:Integration sites sequencing of HIV infection on ZNF417 ZNF587 dKO 293T cells

| PRJNA728901 | ENA

ZNF587

Project description:Homo sapiens ZNF587, zinc finger protein 587 [Source:HGNC Symbol;Acc:HGNC:30955], is expressed in 41 baseline experiment(s);

| ENSG00000198466 | ExpressionAtlas

ZNF587

Project description:Homo sapiens ZNF587, zinc finger protein 587 [Source:HGNC Symbol;Acc:HGNC:30955], is differentially expressed in 130 experiment(s);

| ENSG00000198466 | ExpressionAtlas

Examining the effect of the linker DNA length on protein binding to di-nucleosomes decorated with H3K9me3 and H3K27me3

Project description:Characteristic features of chromatin states are not limited to particular epigenetic modifications but include other regulatory cues, such as linker DNA length, typically ranging from between 35-55 bp (Valouev et al, 2011; Voong et al., 2016, Cell) to over 200 bp in nucleosome-depleted regions (NDRs) found at active enhancers and promoters (Schones et al, 2008; Hansen He et al, 2010). To investigate whether and how the nucleosome linker DNA affects chromatin recognition by nuclear proteins we performed a set of affinity purifications using di-nucleosomes incorporating different DNA linkers. This dataset contains experiments aimed to probe how the linker DNA length affects protein binding to di-nucleosomes decorated with H3K9me3 or H3K27me3. The following di-nucleosomes were used in affinity pull-down purifications with HeLa nuclear extract followed by label-free MS: 1. unmod. H3, 35 bp linker 2. unmod. H3, 40 bp linker 3. unmod. H3, 45 bp linker 4. unmod. H3, 50 bp linker 5. unmod. H3, 55 bp linker 6. H3K9me3, 35 bp linker 7. H3K9me3, 40 bp linker 8. H3K9me3, 45 bp linker 9. H3K9me3 50 bp linker 10. H3K9me3, 55 bp linker 11. H3K27me3, 35 bp linker 12. H3K27me3, 40 bp linker 13. H3K27me3, 45 bp linker 14. H3K27me3, 50 bp linker 15. H3K27me3, 55 bp linker

2023-12-10 | PXD042368 | Pride

KRAB zinc finger proteins ZNF587/ZNF417 protect lymphoma cells from replicative stress-induced inflammation

Project description:The role of Krüppel-associated box zinc finger proteins (KZFPs), the largest family of repressive transcription factors (TFs) of the human genome, in the pathogenesis of diffuse large B cell lymphoma has not been addressed so far. By correlating the expression of KZFPs with patient outcome, we delineated a subset of 18 co-expressed KZFPs associated to poor prognosis, higher copy number alterations (CNA), and the suppression of hallmarks gene sets linked to immune rejection. Among them, the depletion of the ZNF587-ZNF417 pair of TF paralogs drastically impaired the proliferation of both activated B cell (ABC) and germinal center B (GCB) DLBCL cell lines, by triggering replicative stress through the awakening of dormant replication origins and profound alterations of the heterochromatin landscape. ZNF587/417 knockdown profoundly altered the transcriptomic landscape of U2932 (ABC) and OCI-Ly7 (GCB) cells, rewiring gene expression networks associated with good prognosis and upregulating interferon (IFN)/inflammatory-related genes through activation of the cGAS-STING DNA sensing pathway. These cells showed signs of altered immunogenicity with an enhanced MHC class I surface expression and a reshuffling of their immunopeptidome. Our study provides evidence that the ZNF587-ZNF417 paralog pair may promote lymphoma growth, the acquisition of genetic diversity, and its immune evasion by preventing excessive replicative stress. This suggests that these TFs participate in the epigenetic memory of lymphoma cells, thus highlighting the critical role of constitutive heterochromatin in maintaining the identity of poor-prognosis DLBCL.

2024-03-15 | PXD040500 | Pride

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data