Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Gene expression comparison of drug-resistant Panc1/mock cells and Panc1 cells expressing wildtype syk

ABSTRACT: We recently identified the nonreceptor tyrosine kinase syk as a tumor suppressor in pancreatic ductal adenocarcinoma cells. Reintroduction of syk into Panc1 cells promoted a more differentiated phenotype and retarded invasion and tumorigenic growth. Gene array analysis identified over 2,000 transcripts differentially expressed at FDR<0.01. Among these were members of the MMP2 axis, which were subsequently shown to regulate Panc1 invasion. Keywords: Genetic manipulation (stable transgene expression)

ORGANISM(S): Homo sapiens

PROVIDER: GSE18000 | GEO | 2009/09/09

SECONDARY ACCESSION(S): PRJNA119283

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Similar Datasets

Transcription profiling of human drug-resistant Panc1/mock cells and Panc1 cells expressing wildtype syk

Project description:We recently identified the nonreceptor tyrosine kinase syk as a tumor suppressor in pancreatic ductal adenocarcinoma cells. Reintroduction of syk into Panc1 cells promoted a more differentiated phenotype and retarded invasion and tumorigenic growth. Gene array analysis identified over 2,000 transcripts differentially expressed at FDR<0.01. Among these were members of the MMP2 axis, which were subsequently shown to regulate Panc1 invasion. Experiment Overall Design: Affymetrix global gene arrays were used to analyse differences in gene expression patterns in Panc1 cells stably reexpressing syk, or vector-only mock controls. RNA was harvested from cells grown under identical conditions in standard culture.

2009-09-18 | E-GEOD-18000 | biostudies-arrayexpress

Loss of Syk in normal breast cells

Project description:Loss of Syk in normal breast cells in vivo and in vitro: gene expression and phenotypic switch to stem-cell like with induction of invadopodia Morphological and gene microarray analysis following Syk knockdown in MCF10A reveals a loss of luminal and differentiated epithelial features with epithelial to mesenchymal transition and a gain in invadopodia and stem/ progenitor cell marker expression. These results support the role of Syk in limiting normal stem/progenitor proliferation and invasion during morphogenesis, and support the role of Syk as a critical tumor suppressor for breast cancer.

2009-11-20 | GSE16200 | GEO

Expression data from inflamed PANC1 cells

Project description:The effects of mutant p53 on TNFa stimulated PANC1 cells was tested. PANC1 cell harbor endogenous mutation in p53 (R273H). We knocked down this mutp53 (using sirna for p53) and then treated with low doses of TNFa to detect any differential transcription regulation governed by mutp53. A total of 7 samples, 3 of them were duplicated

2013-01-26 | E-GEOD-43738 | biostudies-arrayexpress

Expression data from inflamed PANC1 cells

2013-01-26 | GSE43738 | GEO

SYK activity modulates the EGFR-dependent transcriptome

Project description:Background: Among all gynecologic malignancies, epithelial ovarian cancer has the highest case-to-fatality ratio. Most patients are diagnosed at advanced stages and recurrence is common and accounts for disease-related mortality. Spleen tyrosine kinase (SYK) is an emerging cancer-associated kinase upregulated in recurrent tumors and is amenable for inhibition using small compounds that have been studied in clinical trials for autoimmune diseases. Our previous proteomic analysis identified several novel SYK substrates including EGFR and ERBB2. Here, we investigated the cross-talk between these pathways in ovarian carcinomas. Methods: Immunohistochemistry and immunoblotting were utilized to assess SYK and EGFR phosphorylation in ovarian serous carcinomas. Association with survival was determined by Kaplan-Meier analysis and the log-rank test. To study its role in EGFR signaling, SYK activity was modulated using a small molecule inhibitor, a syngeneic knockout, and an active kinase inducible system. We applied RNA-seq to investigate the SYK-regulated EGF-induced transcriptome. Results: Intense immunoreactivity of active pSYK(Y525/526) correlated with poor overall survival in two independent ovarian cancer cohorts. SYK directly phosphorylated EGFR and ERBB2, while knockout of SYK reduces their phosphorylation. Phosphorylation levels of SYK(Y525/526) positively correlated with EGFR(Y1187) and STAT3(Y705). Active SYK reduced sensitivity to the EGFR/ERBB2 inhibitor, lapatinib, and SYK non-phosphorylatable EGFR mutant was more sensitive to paclitaxel. SYK modulated the EGF-induced transcriptome, supporting its involvement in EGFR/ERBB2-regulated transcriptional activity. Conclusions: Our findings suggest an upstream role of SYK in regulating the EGFR/ERBB2 signaling, and provide a biological rationale for targeting SYK in ovarian cancer therapy.

2020-11-08 | GSE106716 | GEO

A macrophage autonomous alpha4beta1integrin-Syk-Rac2 signaling axis controls macrophage differentiation, tumor growth and metastasis

Project description:Macrophages, play an essential role in promoting tumor growth by affecting angiogenesis, immune suppression, invasion and metastasis. The signal transduction events within macrophages which encode the complex cascade of events required for tumor growth and polarization of macrophages are poorly understood. We have discovered an ECM dependent signaling pathway in macrophages that regulates M2 macrophage differentiation, tumor growth, invasion and metastasis. We provide direct evidence that a macrophage autonomous, M-NM-14M-NM-21 integrin dependent Syk-Rac2 signaling axis acts in concert with the p110 isoform (PTEN-PI-3 kinase pathway) to control metastasis. Bone marrow derived macrophages from five wild type and five Rac2 -/- mutant C57BL mice.

2012-10-02 | E-GEOD-41236 | biostudies-arrayexpress

TREM2 Drives Microglia Response to Amyloid-β via SYK-dependent and -independent Paths [SYK and TREM2 scRNA-seq]

Project description:Genetic studies have highlighted microglia as pivotal in orchestrating Alzheimer’s disease (AD). Microglia that adhere to Aβ plaques acquire a transcriptional signature, “diseaseassociated microglia” (DAM), which largely emanates from the TREM2-DAP12 receptor complex that transmits intracellular signals through the protein tyrosine kinase SYK. The human TREM2R47H variant associated with high AD risk fails to activate microglia via SYK. We found that SYK-deficient microglia cannot encase Aβ plaques, accelerating brain pathology and behavioral deficits. SYK deficiency impaired the PI3K-AKT-GSK3β-mTOR pathway, incapacitating anabolic support required for attaining the DAM profile. However, SYK-deficient microglia proliferated and advanced to an Apoe-expressing prodromal stage of DAM; this pathway relied on the adaptor DAP10, which also binds TREM2. Thus, microglial responses to Aβ involve non-redundant SYK- and DAP10-pathways. Systemic administration of an antibody against CLEC7A, a receptor that directly activates SYK, rescued microglia activation in mice expressing the TREM2R47H allele, unveiling new options for AD immunotherapy.

2022-10-10 | GSE195518 | GEO

PHF13 interacts with EZH2 in Panc1 cells

Project description:PHF13 interacts with EZH2 in Panc1 cells

2022-05-25 | GSE180064 | GEO

Expression analysis of Human pancreatic cancer cell line Panc1 pretreated with DMSO and Clofibrate.

Project description:Investigation of whole genome gene expression level changes of Panc1 pretreated with Clofibrate, compared to Panc1 pretreated with DMSO. Compare differentially expressed genes by analyzing mRNA profilings between DMSO and Clofibrate pretreating Panc1 cell.

2015-06-09 | E-GEOD-69650 | biostudies-arrayexpress

SYK Is a Critical Regulator of FLT3 In Acute Myeloid Leukemia

Project description:Cooperative dependencies between mutant oncoproteins and wild-type proteins are critical in cancer pathogenesis and therapy resistance. Although spleen tyrosine kinase (SYK) has been implicated in hematologic malignancies, it is rarely mutated. We used kinase activity profiling to identify collaborators of SYK in acute myeloid leukemia (AML) and determined that FMS-like tyrosine kinase 3 (FLT3) is transactivated by SYK via direct binding. Highly activated SYK is predominantly found in FLT3-ITD positive AML and cooperates with FLT3-ITD to activate MYC transcriptional programs. FLT3-ITD AML cells are more vulnerable to SYK suppression than FLT3 wild-type counterparts. In a FLT3-ITD in vivo model, SYK is indispensable for myeloproliferative disease (MPD) development, and SYK overexpression promotes overt transformation to AML and resistance to FLT3-ITD-targeted therapy. HL-60, MOLM-14, and U937 cell lines were transduced in triplicate with a control luciferase-directed shRNA (target sequence CCTAAGGTTAAGTCGCCCTCG), and in duplicate with two SYK-directed shRNAs: shSYK_1 (clone ID TRCN0000197257, target sequence GCAGCAGAACAGACATGTCAA) and shSYK_2 (clone ID TRCN0000003163 , target sequence GCAGGCCATCATCAGTCAGAA), and were then selected with 1 Âµg/ml puromycin 48 hours post-infection. At day 5 post-infection, RNA was extracted and profiled using HT HG-U133A arrays (Affymetrix) at the Broad Institute (Cambridge, MA, USA). The computational analysis of the gene expression data was performed through the Genome Space bioinformatics platform (http://www.genomespace.org).

2014-01-15 | E-GEOD-54065 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data