4C-seq analyses of the 3’Igh locus during B cell development
Ontology highlight
ABSTRACT:
ORGANISM(S): Mus musculus
PROVIDER: GSE183006 | GEO | 2021/11/23
REPOSITORIES: GEO
Similar Datasets
Project description:We used 454 sequencing to assess the repertoire of B cell subsets from bone marrow, spleen, and small intestinal lamina propria from two mouse strains. We used a RAG2-GFP reporter mouse strain (129Sve background) to isolate CD19+ RAG2+ B lineage cells from bone marrow and small intestinal lamina propria and total splenic B cells. We used 5' RACE to amplify cDNA libraries using primers specific for the mu constant region of IgH and the Ig kappa constant region. We also used this technique to analyze total B cell libraries from Swiss Webster germ-free mice to compare to littermate controls that were cohoused with regular specific pathogen free (SPF) mice for 7 days. Examination of the Ig kappa repertoire and IgH repertoire in RAG2+ bone marrow B lineage cells compared to RAG2+ small intestinal lamina propria B lineage cells or total splenic B cells. There are 8 (Ig kappa) or 4 (IgH) independent experiments comparing repertoires in RAG2-GFP mice. Each experiment in RAG2-GFP+ mice consisted of a pool of 8-12 mice. There are 3 experiments comparing germ-free to colonized mouse total B cell repertoires, each consisting of one mouse per condition.
2013-07-16 | E-GEOD-48870 | biostudies-arrayexpress
Project description:We used 454 sequencing to assess the repertoire of B cell subsets from bone marrow, spleen, and small intestinal lamina propria from two mouse strains. We used a RAG2-GFP reporter mouse strain (129Sve background) to isolate CD19+ RAG2+ B lineage cells from bone marrow and small intestinal lamina propria and total splenic B cells. We used 5' RACE to amplify cDNA libraries using primers specific for the mu constant region of IgH and the Ig kappa constant region. We also used this technique to analyze total B cell libraries from Swiss Webster germ-free mice to compare to littermate controls that were cohoused with regular specific pathogen free (SPF) mice for 7 days.
2013-07-16 | GSE48870 | GEO
Project description:The immunoglobulin heavy-chain (Igh) locus undergoes large-scale contraction in pro-B cells, which facilitates VH-DJH recombination by juxtaposing distal VH genes next to the DJH- rearranged gene segment in the proximal Igh domain. By high-resolution mapping of long-range interactions, we now demonstrate that an array of local interaction domains establishes the three- dimensional structure of the extended Igh locus in lymphoid progenitors and thymocytes. In pro- B cells, these local domains engage in long-range interactions across the entire Igh locus, which depend on the transcription factors Pax5, YY1 and CTCF. The large VH gene cluster thereby undergoes flexible long-range interactions with the more rigidly structured 3M-bM-^@M-^Y proximal domain, which ensures that all VH genes can participate with similar probability in VH-DJH recombination to generate a diverse antibody repertoire. Notably, these long-range interactions appear to be an intrinsic feature of the VH gene cluster, as they are still generated upon mutation of the EM-NM-< enhancer, IGCR1 insulator or 3M-bM-^@M-^Y regulatory region present in the 3M-bM-^@M-^Y proximal Igh domain. 4C sequencing from mutliple celltypes with multiple viewpoints; uneven number of replicates ChIP-Seq
2013-09-30 | E-GEOD-43008 | biostudies-arrayexpress
Project description:These tracks include chromatin interaction data produced using the 5C (chromatin conformation capture carbon copy) method by the Kenter Lab located at the University of Illinois College of Medicine, Chicago, IL. These tracks show looping interactions across the Igh locus using alternating forward and reverse primer design scheme. The 3C method uses formaldehyde crosslinking to covalently associate interacting chromatin segments in intact cells. The cells are then lysed and chromatin is digested with the Hind III restriction enzyme. The digested fragments are ligated under dilute conditions to promote intra-molecular ligation. A genome-wide interaction library of ligation products corresponding to all possible chromatin interactions is produced by this method. In 5C assays, over 12,000 potential ligation products specific to the Igh locus are detected by PCR using multiplexed primer pairs. Here we focused on the 3’ end of the Igh locus to evaluate the status of the constant region domain of the locus in LPS+IL4 activated splenic B cells. We observe that the configuration of the 3’ end of the Igh locus spanning the CH region genes assumes a developmental stage specific configuration in B lineage B cells. We find that the interaction frequency and activation state of the 3’ enhancer increases as B cells mature.
2021-11-23 | GSE183574 | GEO
Project description:These tracks include chromatin interaction data produced using the 5C (chromatin conformation capture carbon copy) method by the Kenter Lab located at the University of Illinois College of Medicine, Chicago, IL. These tracks show looping interactions across the Igh locus using alternating forward and reverse primer design scheme. The 3C method uses formaldehyde crosslinking to covalently associate interacting chromatin segments in intact cells. The cells are then lysed and chromatin is digested with the Hind III restriction enzyme. The digested fragments are ligated under dilute conditions to promote intra-molecular ligation. A genome-wide interaction library of ligation products corresponding to all possible chromatin interactions is produced by this method. In 5C assays, over 12,000 potential ligation products specific to the Igh locus are detected by PCR using multiplexed primer pairs. Here we focused on the 3’ end of the Igh locus to evaluate the status of the constant region domain of the locus in LPS+IL4 activated splenic B cells. We observe that the configuration of the 3’ end of the Igh locus spanning the CH region genes assumes a developmental stage specific configuration in B lineage B cells. We find that the interaction frequency and activation state of the 3’ enhancer increases as B cells mature.
2021-11-23 | GSE183195 | GEO
Project description:In this study, we compare the chromatin structure of the Ig heavy (IgH) chain locus (performing MNase digestion) in three murine cell types rendered recombinationally inactive by loss of a RAG recombinase: (i) RAG2-/- Pro-B cell lines, where the entire IgH locus is poised and available for recombination, (ii) RAG1-/- Pro-T cell lines, lymphoid cells where the IgH locus is partly open but the V region does not rearrange, (iii) recombinationally inactive RAG2-/- mouse embryonic fibroblasts (MEFs), where the entire IgH locus is in a closed conformation and unavailable for rearrangement. Our findings suggest that developmentally-regulated changes in nucleosome location and occupancy play a fundamental role in regulating V(D)J recombination, by creating and controlling the accessibility of recombination signal sequences.
2016-01-31 | GSE75018 | GEO
Project description:Immunoglobulin class switch recombination (CSR) is initiated by the transcription-coupled recruitment of activation induced cytidine deaminase (AID) to immunoglobulin switch (S) regions. During CSR, the IgH locus undergoes dynamic three-dimensional structural changes in which promoters, enhancers and S regions are brought to close proximity. Nevertheless, little is known about the underlying mechanisms. Here we conditionally inactivated in B cells the Med1 subunit of mediator, a complex implicated in transcription initiation and long-range enhancer/promoter loop formation. We find that Med1-deficiency results in defective CSR, reduced acceptor switch region transcription and that this correlates with reduced long-range interactions between the acceptor switch regions and the Em enhancer, as determined by 4C-Seq. Our results implicate the mediator complex in the mechanism of CSR and are consistent with a model in which Med1 facilitates the transcriptional activation of switch regions and their long-range contacts with the IgH locus enhancers during CSR. 4C-seq data in resting and activated WT and Med1 mutant B cells. 4C bait was designed in the Eu enhancer of the Igh locus on chromosome 12. Primer sequences: 5â TCTGTCCTAAAGGCTCTGAGA 3â and 5â GAACACAGAAGTATGTGTATGGA 3â.
2016-02-17 | E-GEOD-62969 | biostudies-arrayexpress
Project description:VH-DJH recombination of the immunoglobulin heavy-chain (Igh) locus is temporally and spatially controlled during early B-cell development, and yet no regulatory elements other than the VH gene promoters have been identified throughout the entire 2.5-Mb VH gene cluster. Here we discovered novel regulatory sequences that are interspersed in the distal VH gene region. These conserved repeat elements were characterized by the presence of Pax5-dependent active chromatin, the binding of Pax5, E2A, CTCF and Rad21 as well as by Pax5-dependent antisense transcription in pro-B cells. The Pax5-activated intergenic repeat (PAIR) elements were no longer bound by Pax5 in pre-B and B cells consistent with the loss of antisense transcription, whereas E2A and CTCF interacted with PAIR elements throughout early B-cell development. The pro-B-cell-specific and Pax5-dependent activity of the PAIR elements suggests that they are involved in the regulation of distal VH-DJH recombination at the Igh locus. Analysis of chromatin and TF binding in rag2-/- and pax5-/- rag2-/- pro-B cells. Chip-Chip with one experiment for each antibody, 12 samples.
2011-02-11 | E-GEOD-27074 | biostudies-arrayexpress
Project description:We use polyclonal Ighγ1/γ1 and Ighε/ε mice (which initially produce only IgG1 or IgE from their respective native genomic configurations) to examine the role of IgH isotype on BCR function. We use microarray expression analysis to compare the internal state of the three IgH isotype specific B-cells. Microarray was used to compare the expression level of various genes in splenic follicular B-cells of Ighε/ε, Ighγ1/γ1 and Ighwt mice. Each mouse strain also had a naturally pre-assembled Ig light chain (VJk5).
2017-01-06 | GSE93209 | GEO
Project description:Purpose: IGH sequencing has revolutionized analysis of structural and functional signatures of B cell clonality. The goals of this study are to compare IGH repertoire of splenic B cells before and after knockdown of long isoform of PRLR. Methods: After amplifying the IGH repertoire of splenic B cells using PCR primers for VHJ558 variable and Cμ constant regions. For next generation sequencing (NGS), a TrueSeq library was prepared by adapter ligation to full-length products and sequenced on the MiSeq Illumina 2x150 bp platform. Results: In this project, Unique nucleotide sequences were identified, their abundances were calculated, and their complementary determining region 3 (CDR3) length, CDR3 spectrum, VDJ usage, and diversity were analyzed using the International Immunogenetics Information System (IMGT) HighV-QUEST software. Controls are included C3,C4,C5,C7,C8 and C9. LFPRLR SMO treated mice samples are: A3,A4,A5,A6,A7 and A8
2023-03-06 | GSE207186 | GEO