Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Expression consequences of decoy vs scrambled oligonucleotides harboring AAAA[AGT]TT motif in MBA-MD-231 cell line

ABSTRACT: Dual-color transcriptional profiling of decoy-transfected cells, harboring AAAA[AGT]TT motif, versus scrambled-transfected cells as controls.

ORGANISM(S): Homo sapiens

PROVIDER: GSE18844 | GEO | 2009/11/04

SECONDARY ACCESSION(S): PRJNA123851

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Similar Datasets

Decoy vs Scrambled and siRNA vs Mock Transfected MBA-MD-231 Cell Line

Project description:This SuperSeries is composed of the SubSeries listed below.

2009-11-04 | GSE18874 | GEO

Cell cycle motif decoy oligos

Project description:Single-stranded oligos listed below (and the corresponding reverse compliment) were synthesized and annealed: E2F: CTAGATTTCCCGCGGATC (decoy); CTAGACTCTGCTCGGATC (scrambled) KTGGYRSGAA: CTAGATTCCCGCCAAGGATC (decoy); CTAGACAGCTACTCCGGATC (scrambled) TGCGCANK: CTAGACATGCGCAGGATC (decoy); CTAGATCACAGGCGGATC (scrambled) CCAATNNSNNNGCG: CTAGACGCCCTCCGATTGGGGATC (decoy); CTAGATGCACGCTCGGTCCGGATC (scrambled) ACTWSNACTNY: CTAGAGGAGTTGTAGTGGATC (decoy); CTAGAGATAGTGTGTGGGATC (scrambled) HeLa cells were propagated in DMEM (Invitrogen) plus 10% FBS and transfected with 0.5 uM of double-stranded DNA. Total RNA was extracted with TRIzol (Invitrogen) from HeLa cells 2 d after transfection of the indicated decoy oligo or scrambled oligo in duplicate. RNA was amplified using the Ambion Amino Allyl MessageAmp II aRNA kit. For each motif, decoy oligo transfected samples (labeled with Cy5) and the corresponding scrambled oligo transfected samples (labeled with Cy3) were competitively hybridized to HEEBO microarrays as described (http://www.microarray.org/sfgf/heebo.do).

2012-08-23 | GSE39572 | GEO

Cell cycle motif decoy oligos

2012-08-23 | E-GEOD-39572 | biostudies-arrayexpress

Specific inhibition of splicing factor activity by decoy RNA oligonucleotides

Project description:Alternative splicing, a fundamental step in gene expression, is deregulated in many diseases. Splicing factors (SFs), which regulate this process, are up- or down regulated or mutated in several diseases including cancer. To date, there are no inhibitors that directly inhibit the activity of SFs. We designed decoy oligonucleotides, composed of several repeats of a RNA motif, which is recognized by a single SF. Here we show that decoy oligonucleotides targeting splicing factors RBFOX1/2, SRSF1 and PTBP1, can specifically bind to their respective SFs and inhibit their splicing and biological activities both in vitro and in vivo. These decoy oligonucleotides present a novel approach to specifically downregulate SF activity and have the potential to treat diseases where SFs are up-regulated, such as cancer.

2019-02-14 | GSE126503 | GEO

sRSM1 synthetic decoy vs. scrambled transfections in MDA-MB-231 cells

Project description:Transcriptional profiling of MDA-MB-231 comparing the regulatory consequences of transfecting synthetic decoys carring sRSM1 motifs versus synthetic scrambled oligos Two decoy/scrambled sets, each with two biological replicates

2012-02-28 | E-GEOD-35749 | biostudies-arrayexpress

ELK1 and NFYA knockdown in MBA-MD-231 cell line

Project description:Dual-color transcriptional profiling of siRNA-transfected cells, targeting ELK1 and NFYA, versus mock-transfected cells.

2009-11-04 | GSE18849 | GEO

Specific inhibition of splicing factor activity by decoy RNA oligonucleotides

2019-01-31 | PXD012564 | Pride

Project description:tt

| PRJEB51254 | ENA

TT-TL-seq reveals transcriptional profiles that accompany DoG induction after hyperosmotic stress.

Project description:TT-TimeLapse-seq was used to investigate the nascent transcription profiles that accompany the induction of downstream-of-gene (DoG) containing transcripts in human cell lines. Data from HEK-293T cells exposed to hyperosmotic stress and cells transfected with siRNAs against Integrator subunit 11 are included.

2021-01-04 | GSE152059 | GEO

Specific inhibition of splicing factor activity by decoy RNA oligonucleotides

Project description:Specific inhibition of splicing factor activity by decoy RNA oligonucleotides

| PRJNA522237 | ENA