Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Genome-wide profiling of SMARCA4 in neuroblastoma cells [ChIP-seq]

ABSTRACT: To reveal the genome-wide targets of SWI/SNF complexes in neuroblastoma cells, we performed ChIP-seq of SMARCA4 (BRG1) in IMR-32, KELLY, and SK-N-DZ cells. We used these libraries to examine chromatin occupancy profiling. Analysis of locations reveal that SMARCA4 targets directly regulate sites regulated by the neuroblastoma core regulatory circuitry.

ORGANISM(S): Homo sapiens

PROVIDER: GSE190707 | GEO | 2023/10/24

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Similar Datasets

Transcriptional effects of SMARCA4 inhibition on neuroblastoma cells [4sU RNA-seq]

Project description:To reveal fast-acting transcriptional effects of SWI/SNF inhibition in neuroblastoma cells, we performed 4sU metabolic labeling followed by RNA-seq in IMR-32, KELLY, and SK-N-DZ cells and compared the effects of BRM014 with DMSO vehicle control. We also compared these effects to auxin-induced degradation of SMARCA4 in engineered cells with the minimal auxin-induced degron (SMARCA4-mAID). Analysis of transcripts reveal that SMARCA4 inhibition leads to suppression of transcripts involved in the G1 checkpoint.

2023-10-24 | GSE190708 | GEO

DNA accessibility sites requiring SMARCA4 activity in neuroblastoma cells [ATAC-seq]

Project description:To reveal the genome-wide targets of SWI/SNF complexes in neuroblastoma cells, we performed ATAC-seq in IMR-32 cells with or without SMARCA4 inactivation. To identify changes in DNA accessibility following SMARCA4 inactivation, we used either the small-molecule catalytic inhibitor BRM014, auxin-induced degradation of IMR-32 cells engineered with SMARCA4 tagged to the minimal auxin-induced degron (SMARCA4-mAID), or the corresponding vehicle controls. Analysis of these locations reveal that SMARCA4-dependent sites are located at enhancers used by the neuroblastoma core regulatory circuitry.

2023-10-24 | GSE190706 | GEO

BRG1/SMARCA4 is essential for neuroblastoma cell viability through modulation of cell death and survival pathways

Project description:Neuroblastoma (NB) is a neoplasm of the sympathetic nervous system, and is the most common solid tumor of infancy. NBs are very heterogeneous, with a clinical course ranging from spontaneous regression to resistance to all current forms of treatment. High-risk patients need intense chemotherapy, and only 30-40% will be cured. Relapsed or metastatic tumors acquire multi-drug resistance, raising the need for alternative treatments. Owing to the diverse mechanisms that are responsible of NB chemoresistance, we aimed to target epigenetic factors that control multiple pathways to bypass therapy resistance. We found that the SWI/SNF-related, matrix-associated, actin- dependent regulator of chromatin, subfamily a, member 4 (SMARCA4/BRG1) was consistently upregulated in advanced stages of NB, with high BRG1 levels being indicative of poor outcome. Loss-of-function experiments in vitro and in vivo showed that BRG1 is essential for the proliferation of NB cells. Furthermore, whole genome transcriptome analysis revealed that BRG1 controls the expression of key elements of oncogenic pathways such as PI3K/AKT and BCL2, which offers a promising new combination therapy for high-risk NB Non-silencing control (NSC) or shBRG1 lentiviral vectors were transduced in the Neuroblastoma cell lines SK-N-BE(2) by triplicate. 48h post-infection, total RNA was extracted

2016-03-01 | E-GEOD-74622 | biostudies-arrayexpress

Microarray analysis of ATP-dependent chromatin remodeller BRG1/SMARCA4 mediated gene expression in primary human keratinocytes (PHEKs) after scratch wound assay.

Project description:siRNA mediated knockdown of BRG1/SMARCA4 in scratch wounded cell culture PHEKs, used to identify specific BRG1/SMARCA4 dependent gene expression programs which are initiated during immediate and early (1h and 24h) epithelial wounding. 3 human donors.

2022-12-01 | E-MTAB-12452 | biostudies-arrayexpress

Integrated genome, transcriptome and translatome profiling of neuroblastoma cells

Project description:Microarray-based genome-wide measurements of copy number alterations and of transcriptome variations are proposed for neuroblastoma prognosis and possible treatment choice. Nonetheless, they lack to provide clues on a neglected layer of systems-level changes, the translatome, whose variations are defined by the activity of the translational regulatory machinery. Our study extends the conventional genome-wide approaches to translatome profiling in neuroblastoma, by means of polysomal sucrose gradient separation followed by microarray analysis. The panel of fourteen parental (not subcloned) neuroblastoma cell lines used in the study includes: CHP-134, SIMA, NB-69, LAN-1, KELLY, CHP-126, CHP-212, SK-N-BE(2), IMR-32, SK-N-AS, SK-N-SH, STA-NB-7, STA-NB-1, STA-NB-10 cells. Each cell line has been profiled with high resolution array CGH analysis for copy number changes, and for transcriptome and translatome variations. The integration of these three types of data sets obtained from the same cells can provide information on the impact in neuroblastoma of a defined pattern of genomic lesions on both transcriptional and translational alterations of gene expression.

2010-12-31 | GSE22785 | GEO

4C sequencing for the SOX11 promoter in the neuroblastoma cell lines CLB-GA, KELLY, SK-N-AS and SH-EP

Project description:4C sequencing for the SOX11 promoter in the neuroblastoma cell lines CLB-GA, KELLY, SK-N-AS and SH-EP.

2023-02-19 | E-MTAB-12580 | biostudies-arrayexpress

mRNA expression profiles of TAE-684 treated or shALK transfected neuroblastoma cell lines

Project description:Human wild-type ALK (SK-N-AS, NGP, IMR-32), ALKR1275Q (CLB-GA, LAN-5, UKF-NB-3), ALKF1174L (SK-N-SH, Kelly, SMS-KCNR) and ALK amplified (NB-1) neuroblastoma cell lines were treated in triplicate with 0.3M-k_M NPV-TAE-684 (Novartis/SelleckChem) or DMSO (VWR) for 6 hours, followed by RNA isolation and gene expression profiling. For shRNA mediated knockdown, pGIPZ-ALK shRNAmir and pGIPZ-non-silencing control shRNAmir vectors were used (Open Biosystems). The ALK shRNA was directed against a part of exon 26 in the tyrosine kinase domain of ALK (target sequence: TGGAAGGAATATTCACTTCTAA). Lentiviral particles were produced according to manufacturerM-^IM-[M-*s protocol (Open Biosystems). On day 2 post-transduction of neuroblastoma cells, the transduction efficiency was determined by flow cytometry and microscopic analysis of GFP-positive cells (>90% so no further selection was performed). Cells were subsequently harvested for expression profiling. Labeling of the RNA samples and hybridisation to the Affymetrix HG-U133plus2 arrays was performed using the manufacturerM-^IM-[M-*s protocol starting from 1 M-eM-5g of RNA.

2015-05-04 | E-MTAB-3205 | biostudies-arrayexpress

SMARCA4 regulates gene expression and higher-order chromatin structure in proliferating mammary epithelial cells

Project description:The packaging of DNA into chromatin plays an important role in transcriptional regulation and nuclear processes. Brahma related gene-1 SMARCA4 (also known as BRG1), the essential ATPase subunit of the mammalian SWI/SNF chromatin remodeling complex, uses the energy from ATP hydrolysis to disrupt nucleosomes at target regions. Although the transcriptional role of SMARCA4 at gene promoters is well-studied, less is known about its role in higher-order genome organization. SMARCA4 knockdown in human mammary epithelial MCF-10A cells resulted in 176 up-regulated genes, including many related to lipid and calcium metabolism, and 1292 down-regulated genes, some of which encode extracellular matrix (ECM) components that can exert mechanical forces and affect nuclear structure. ChIP-seq analysis of SMARCA4 localization and SMARCA4-bound super-enhancers demonstrated extensive binding at intergenic regions. Furthermore, Hi-C analysis showed extensive SMARCA4-mediated alterations in higher-order genome organization at multiple resolutions. First, SMARCA4 knockdown resulted in clustering of intra- and inter- sub-telomeric regions, demonstrating a novel role for SMARCA4 in telomere organization. SMARCA4 binding was enriched at TAD (Topologically Associating Domain) boundaries, and SMARCA4 knockdown resulted in weakening of TAD boundary strength. Taken together, these findings provide a dynamic view of SMARCA4-dependent changes in higher-order chromatin organization and gene expression, identifying SMARCA4 as a novel component of chromatin organization. Hi-C and RNA-seq experiments were conducted in MCF-10A shSCRAM and shSMARCA4 cells. SMARCA4 ChIP-seq was conducted in wildtype MCF-10A cells.

2016-06-02 | E-GEOD-74716 | biostudies-arrayexpress

FOXP1 inhibits cell growth and attenuates tumorigenicity of neuroblastoma

Project description:Single-color gene expression profiles from 3 neuroblastoma cell lines were generated using 44K oligonucleotide microarrays. To gain insights into the molecular processes occurring upon FOXP1 re-expression, we performed series of time-resolved gene expression measurements in FOXP1 and GFP transgenic neuroblastoma cell lines. Single-color gene expression profiles from 3 neuroblastoma cell lines were generated using 44K oligonucleotide microarrays. Total RNA of FOXP1- and GFP-expressing IMR-32, CHP-212 and SK-N-BE(2) cells was isolated at 0, 12, 24 and 72 h using Trizol. To determine global differences in the expression profiles of FOXP1- and GFP-induced IMR-32, CHP-212 and SK-N-BE(2) cells, mean expression levels of each gene between FOXP1-induced and control (GFP) cells were compared.

2014-10-17 | E-GEOD-62419 | biostudies-arrayexpress

Transcription profiling of human neuroblastoma cells lines following DAC and ATRA treatment

Project description:Following treatment with the de-methylating agent 5-aza-deoxycytidine (DAC), the gene expression profiles of neuroblastoma cell lines Kelly, SK-N-AS and NGP were analysed in order to examine the relationship between transcriptional re-activation and promoter region DNA methylation.<br>In addition, the neuroblastoma cell line SK-N-BE was treated with all-trans-retinoic acid (ATRA) in order to examine the impact this differentiation agent has on DNA methylation status.

2010-11-03 | E-MEXP-2557 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data