Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Transcriptome-wide N6-Methyladenosine (m6A) modifications in Anopheles sinensis

ABSTRACT: We profile transcriptome-wide m6A in female and male Anopheles sinensis and reveal that m6A is also a highly conserved modification of mRNA in mosquitoes were generated by deep sequencing, in triplicate, using illumina Novaseq™ 6000. Distinct from mammals and yeast, but similar to Arabidopsis thaliana, m6A in An. sinensis is enriched not only around the stop codon and within 3’-untranslated regions, but also around the start codon and 5’-UTR. Gene ontology analysis indicates that the unique distribution pattern of m6A in An. sinensis is associated with mosquito sex-specific pathways. In addition, the positive correlation between m6A deposition and mRNA abundance indicates that m6A can play roles in regulating gene expression in mosquitoes. Our study proposed a transcriptional regulatory network of m6A in An. sinensis, which may provide a new clue for the control of this disease-transmitting vector.

ORGANISM(S): Anopheles sinensis

PROVIDER: GSE193379 | GEO | 2022/05/18

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Similar Datasets

microRNA profile of adult female Anopheles sinensis

Project description:We investigate the global miRNA expression profile of An. sinensis using illumine Hiseq 2000 sequencing.The annotation and prediction of miRNAs lays the foundation for the further functional study of An. sinensis miRNAs and will facilitate their application in vector control.

2018-09-27 | GSE109005 | GEO

CpG Oligodeoxynucleotides treatment of Anopheles mosquitoes

2013-04-02 | GSE26941 | GEO

CpG Oligodeoxynucleotides treatment of Anopheles mosquitoes

Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed. Anopheles gambiae s.s. mosquitoes were reared at 25 M-BM-:C and 75% humidity with a 12-hour light/dark cycle. Adult mosquitoes were maintained on a 10% glucose solution. Three- to four-day-old female mosquitoes were cold-anaesthetized and inoculated intratoraxically with 69nl of a 0.1mM CpG-oligodeoxynucleotide (0604 -5M-bM-^@M-^Y TCCATGACGTTCCTGATGCT 3M-bM-^@M-^Y) solution or with the same volume of elution buffer using a Nanoject micro-injector (Drummond Scientific). Mosquitoes were left to rest for 18h. Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Two independent experiments were performed for each treatment.

2013-04-02 | E-GEOD-26941 | biostudies-arrayexpress

Anopheles sinensis

Project description:Anopheles sinensis overview

| PRJNA79041 | ENA

Anopheles sinensis

Project description:Anopheles sinensis Genome sequencing

| PRJNA78949 | ENA

Anopheles sinensis

Project description:Anopheles sinensis adult female sialotranscriptome

| PRJNA321832 | ENA

Anopheles sinensis

Project description:The transcriptome sequencing of Anopheles sinensis