Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

RNA-seq of HNRNPAB morpholino in zebrafish

ABSTRACT: To investigate the transcriptomic alterations following 24hpf knockdown of the gene HNRNPAB in zebrafish, we injected HNRNPAB morpholino with 3ng and 6ng into 1-cell zebrafish embryos separately, and the 24hpf embryos were collected for RNA-seq.

ORGANISM(S): Danio rerio

PROVIDER: GSE199586 | GEO | 2022/03/31

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Similar Datasets

RNA-seq of HNRNPAB morpholino in zebrafish

Project description:RNA-seq of HNRNPAB morpholino in zebrafish

| PRJNA820769 | ENA

Transcription profiling of zebrafish embryos injected with DrC1q-like morpholino and control morpholino

Project description:Except complement C1q, the immunological functions of other C1q family members have remained unclear. In vitro studies showed that DrC1q-like could inhibit the apoptosis induced by ActD and CHX in EPC cells, through repressing the activation of caspase 3/9. Moreover, its physiological roles were studied by morpholino-mediated knockdown in zebrafish embryogenesis; We used microarrays to compare the global programme of gene expression of DrC1q-like deficient embryos and control embryos. And identified distinct classes of up-regulated and down-regulated genes in DrC1q-like deficient embryos. Experiment Overall Design: Zebrafish embryos were selected at 24hpf for RNA extraction and hybridization on Affymetrix microarrays. We sought to obtain expression profiles of DrC1q-like deficient embryos compared to the control. And we could find out which genes and pathways were affected by DrC1q-like

2008-06-16 | E-GEOD-8800 | biostudies-arrayexpress

Xenopus laevis embryos and animal caps: Control vs PouV morpholino

Project description:Transcriptional profiling of Xenopus laevis embryos and ectoderm (animal caps) comparing embryos injected with control morpholino with embryos injected with the morpholino mixture PVD2, which knocks down all three Xenopus PouV proteins. Whole embryos (WE) or animal caps (AC) were collected at late blastula (9) or early gastrula (10) stages from Control and PVD2 morphants.

2013-11-12 | GSE47578 | GEO

Transcriptional profiling of embryonic zebrafish expressing a mutant TNNT2

Project description:Transcriptional profiling of embryonic zebrafish injected with a control morpholino or a morpholino that causes exclusion of TNNT2 exon 13. Zebrafish embryos were injected with a antisense morpholino oligo that induced missplicing of exon 13 of TNNT2 (TNNT2sp) or a control morpholino. At 96hpf these embryos were euthanized and RNA was collected.

2010-12-31 | E-GEOD-20179 | biostudies-arrayexpress

Identification of differentially-expressed genes between FoxH1 morpholino and control in zebrafish embryos.

Project description:The Forkhead Box H1 (FoxH1) protein is a co-transcription factor recruited by phosphorylated Smad2 downstream of several TGFbetas, including Nodal-related proteins. We have reassessed the function of zebrafish FoxH1 using antisense morpholino oligonucleotides (MOs) ( 5’ TGCTTTGTCATGCTGATGTAGTGGG 3’) as compared with a control morpholino (MO) with no specific target (5’ TAGTTAAGCCTAGCTCTCATAAACT 3’). Probing FoxH1 morphant RNA by microarray, we identified a cohort of five keratin genes – cyt1, cyt2, krt4, krt8 and krt18 - that are normally transcribed in the embryo’s enveloping layer (EVL) and which have significantly reduced expression in FoxH1-depleted embryos. Keywords: 40% epiboly-stage embryos, injected with either 8 ng of a 25mer morpholino (MO) with no specific target or 8 ng of a 25mer MO with reverse complementary to the 5’ untranslated region of the zebrafish foxH1 gene.

2007-07-30 | GSE8076 | GEO

Zebrafish embryos: hdac1 Morphants vs Standard control morphants

Project description:Transcriptional profiling of hdac1 morphant zebrafish embryos in comparison to standard control injected embryos. Embryos where injected at the one cell stage with either a translation blocking morpholino (Hdac1 ATG), splice blocking morpholino (Hdac1 Splice) or Hdac1 mismatch control morpholino (Hdac1 control). RNA was extracted and compared in a two-colour hybridisation to the comman reference Standard control morpholino injected embryos.

2011-01-21 | GSE26708 | GEO

Transcription profiling of zebrafish embryos injected with a morpholino targeting LIN9

Project description:TÜAB zebrafish were maintained at 28.5 °C in in 1x Danieau solution (58 mM NaCl, 0.7 mM KCl, 0.4 mM MgSO4, 0.6 mM Ca (NO3)2, 5 mM HEPES, pH 7.6, 0.0001 % Methylene blue). Morpholinos (Gene Tools, Philomath, OR) were designed against Danio rerio lin-9 homolog (Genebank accession NM_001044946). The morpholino (MO) sequences were MO-E1 5´-GTTAGTTTTATTACTCACTCTCGTC-3´ and 5-base mismatch morpholino MO-E1mis 5´-GTTACTTTTAATACTGACTGTCCTC-3´. 7 ng of morpholinos were injected into one cell-stage embryos. 20 embryos per condition (MO E1; MO E1mis) were pooled for RNA purification 24 h post fertilization. Using the two color Quick-Amp Labeling Kit (Agilent; 5190-0444) 100 ng of total RNA were used for cDNA synthesis, mRNA amplification and labeling according to manufacturers instructions. Transcriptional profiling was done on a zebrafish oligo array (Agilent; G2519F AMADID 019161) in a 4 x 44K slide format and analyzed as described before.<br>

2009-03-28 | E-MEXP-2100 | biostudies-arrayexpress

Zebrafish embryos: hdac1 Morphants vs Standard control morphants at 12, 18 and 27 hpf

Project description:Transcriptional profiling of hdac1 ATG morphant zebrafish embryos in comparison to standard control injected embryos. Embryos where injected at the one cell stage with either a translation blocking morpholino (Hdac1 ATG) or Standard control morpholino (StCo). RNA was extracted at 12, 18 and 27hpf from both sets of embryos and compared with a two-colour hybridisation.

2011-01-21 | GSE26709 | GEO

Zebrafish embryos: hdac1 Morphants vs Standard control morphants

2011-01-21 | E-GEOD-26708 | biostudies-arrayexpress

Traf6 function in the innate immune response of zebrafish embryos

Project description:Transcriptional profiling of the zebrafish embryonic host response to a systemic bacterial infection with Salmonella typhimurium (strain SL1027); comparison between traf6 knock-down and control morpholino treated embryos. All infection experiments were performed using mixed egg clutches of ABxTL strain zebrafish. Embryos injected with traf6 morpholino or a 5bp mismatch control morpholino were staged at 27 hours post fertilization (hpf) by morphological criteria and approximately 250 cfu of DsRed expressing Salmonella bacteria were injected into the caudal vein close to the urogenital opening. As a control an equal volume of PBS was likewise injected. Pools of 20-40 infected and control embryos were collected 8 hours post infection (hpi). The whole procedure was preformed in triplicate on separate days. Total RNA of the biological triplicates was pooled using equal amounts of RNA prior to RNAseq library preparation.

2010-08-01 | E-GEOD-21024 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data