Effects of matrine on gene expression of myeloid leukemia cells
Ontology highlight
ABSTRACT:
ORGANISM(S): Homo sapiens
PROVIDER: GSE201309 | GEO | 2022/11/09
REPOSITORIES: GEO
Similar Datasets
Project description:To identify the mechanisms controlling chronic myeloid leukemia (CML) and acute myeloid leukemia (AML) in humans, we analyzed genome-wide transcription dynamics in three myeloid leukemia cell lines (K562, HL-60, and THP1) using high-throughput sequencing technology. Using KEGG analysis, we found that the ERK/MAPK, JAK-STAT and ErbB pathways promoted proliferation and metabolism in CML. However, in AML, differentiation and apoptosis blocking resulted in the accumulation of blast cells in marrow. In addition, each cell type had unique characteristics. K562 cells are an ideal model for studying erythroid differentiation and globin gene expression. The chemokine signaling pathway and Fc gamma R-mediated phagocytosis were markedly upregulated in HL-60 cells. In THP1 cells, highly expressed genes ensured strong phagocytosis by monocytes. Further, we provide a new insight into myeloid development. The abundant data sets and well-defined analysis methods will provide a resource and strategy for further investigation of myeloid leukemia. Compare mRNA transcriptomes of three different cell lines
2013-10-09 | E-GEOD-46164 | biostudies-arrayexpress
Project description:To identify the mechanisms controlling chronic myeloid leukemia (CML) and acute myeloid leukemia (AML) in humans, we analyzed genome-wide transcription dynamics in three myeloid leukemia cell lines (K562, HL-60, and THP1) using high-throughput sequencing technology. Using KEGG analysis, we found that the ERK/MAPK, JAK-STAT and ErbB pathways promoted proliferation and metabolism in CML. However, in AML, differentiation and apoptosis blocking resulted in the accumulation of blast cells in marrow. In addition, each cell type had unique characteristics. K562 cells are an ideal model for studying erythroid differentiation and globin gene expression. The chemokine signaling pathway and Fc gamma R-mediated phagocytosis were markedly upregulated in HL-60 cells. In THP1 cells, highly expressed genes ensured strong phagocytosis by monocytes. Further, we provide a new insight into myeloid development. The abundant data sets and well-defined analysis methods will provide a resource and strategy for further investigation of myeloid leukemia.
2013-10-09 | GSE46164 | GEO
Project description:All-trans retinoic acid (ATRA)-based differentiation therapy has achieved success with the treatment of acute promyelocytic leukemia (APL), a unique subtype of acute myeloid leukemia (AML). However, other subtypes of AML display resistance to ATRA-based treatment. Here, we demonstrate that a novel natural vibsane-type diterpenoid vibsanine A promotes the differentiation of myeloid leukemia cell lines and primary AML blasts. To reveal how vibsanine A function on promoting myeloid leukemia cell differentiation, we analyzed and compared the gene expression profiles in myeloid leukemia HL-60 cells treated with vibsanine A, PMA, and ATRA. HL-60 cells were treated with vibsanine A, PMA and ATRA for 6 hours or longer up to 24 hours. Gene expression profiling was conducted
2016-02-28 | E-GEOD-78734 | biostudies-arrayexpress
Project description:This study produced a microarray-based screening for miRNAs responding to tetradecanoyl phorbol acetate (TPA) (for monocytic differentiation) treatment in various leukemia cell lines. Using the microarray technique, global changes in miRNA expression after treatment of four leukemia cell lines (NB4, HL-60, U937 and K562) with TPA was profiled. This microarray chip contained 924 probes for 802 miRNAs from human, mouse and rat after discarding redundant sequences, and a further 122 predicted miRNA sequences from published data. To reduce individual variability, replicate array analysis used independently treated samples, and a technical replicate was also performed with the same sample.
2013-12-01 | E-GEOD-33537 | biostudies-arrayexpress
Project description:All-trans retinoic acid (ATRA)-based differentiation therapy has achieved success with the treatment of acute promyelocytic leukemia (APL), a unique subtype of acute myeloid leukemia (AML). However, other subtypes of AML display resistance to ATRA-based treatment. Here, we demonstrate that a novel natural vibsane-type diterpenoid vibsanin A promotes the differentiation of myeloid leukemia cell lines and primary AML blasts. To reveal how vibsanin A function on promoting myeloid leukemia cell differentiation, we analyzed and compared the gene expression profiles in myeloid leukemia HL-60 cells treated with vibsanin A, PMA, and ATRA.
2016-02-28 | GSE78734 | GEO
Project description:Transcriptomic profile study comparing human acute leukemia derived cell lines HL-60 and OCI-AML3 treated with the antitumoral peptide CIGB-300 at 30min and at 3h. CIGB-300 is an antitumoral peptide that blocks CK2 phospho-acceptor sites on their substrates but it also binds to CK2α catalytic subunit. This peptide has demonstrated their antiproliferative effects on different models including acute leukemia cells and also their antitumoral action in animal models and in clinical assays. We performed a Clariom S HT microarray gene RNA expression profiling to study the molecular events supporting the anti-leukemic effect of CIGB-300 peptide on HL-60 and OCI-AML3 cell lines.
2023-07-04 | GSE228172 | GEO
Project description:We used an in vivo short hairpin RNA (shRNA) screening approach to identify genes that are essential for MLL-AF9 acute myeloid leukemia (AML). We found that Integrin Beta 3 (Itgb3) is essential for murine leukemia cells in vivo, and for human leukemia cells in xenotransplantation studies.M-BM- In leukemia cells, Itgb3 knockdown impaired homing, downregulated LSC transcriptional programs, and induced differentiation via the intracellular kinase, Syk.M-BM- In contrast, loss of Itgb3 in normal HSPCs did not affect engraftment, reconstitution, or differentiation. M-BM- Finally, we confirmed that Itgb3 is dispensable for normal hematopoiesis and required for leukemogenesis using an Itgb3 knockout mouse model.M-BM- Our results establish the significance of the Itgb3 signaling pathway as a potential therapeutic target in AML. R940406 (R406, the active metabolite of fostamatinib) was supplied by Rigel Pharmaceuticals, Inc., South San Francisco, CA, and AstraZeneca Pharmaceuticals, Wilmington, DE, USA. R406 was resuspended in dimethyl sulfoxide (DMSO) (Sigma-Aldrich) and stored at M-bM-^HM-^R80M-BM-0C. . HL-60, U937 and KG-1 cell lines were purchased from the American Type Culture Collection. MOLM-14 cell lines were provided by Dr. Scott Amstrong (Dana-Farber Cancer Institute, Boston MA, USA.) All cell lines were maintained in RPMI 1640 (Cellgro) supplemented with 1% penicillin-streptomycin and 10% fetal bovine serum (FBS, Sigma-Aldrich) at 37 M-BM-0C with 5% CO2. MOLM-14, U937, HL-60 and KG-1 cells were grown in 4mM R406 for 24 hours
2013-04-24 | E-GEOD-46302 | biostudies-arrayexpress
Project description:Cooperative dependencies between mutant oncoproteins and wild-type proteins are critical in cancer pathogenesis and therapy resistance. Although spleen tyrosine kinase (SYK) has been implicated in hematologic malignancies, it is rarely mutated. We used kinase activity profiling to identify collaborators of SYK in acute myeloid leukemia (AML) and determined that FMS-like tyrosine kinase 3 (FLT3) is transactivated by SYK via direct binding. Highly activated SYK is predominantly found in FLT3-ITD positive AML and cooperates with FLT3-ITD to activate MYC transcriptional programs. FLT3-ITD AML cells are more vulnerable to SYK suppression than FLT3 wild-type counterparts. In a FLT3-ITD in vivo model, SYK is indispensable for myeloproliferative disease (MPD) development, and SYK overexpression promotes overt transformation to AML and resistance to FLT3-ITD-targeted therapy. HL-60, MOLM-14, and U937 cell lines were transduced in triplicate with a control luciferase-directed shRNA (target sequence CCTAAGGTTAAGTCGCCCTCG), and in duplicate with two SYK-directed shRNAs: shSYK_1 (clone ID TRCN0000197257, target sequence GCAGCAGAACAGACATGTCAA) and shSYK_2 (clone ID TRCN0000003163 , target sequence GCAGGCCATCATCAGTCAGAA), and were then selected with 1 µg/ml puromycin 48 hours post-infection. At day 5 post-infection, RNA was extracted and profiled using HT HG-U133A arrays (Affymetrix) at the Broad Institute (Cambridge, MA, USA). The computational analysis of the gene expression data was performed through the Genome Space bioinformatics platform (http://www.genomespace.org).
2014-01-15 | E-GEOD-54065 | biostudies-arrayexpress
Project description:miRNA microarray expression analysis of human acute myeloid leukemia cell line (U937) after HDAC2 genetically and enzymatically defection
2019-10-28 | GSE129154 | GEO
Project description:We developed a general approach to small molecule library screening called GE-HTS (Gene Expression-Based High Throughput Screening) in which a gene expression signature is used as a surrogate for cellular states and applied it to the identification of compounds inducing the differentiation of acute myeloid leukemia cells. In screening 1,739 compounds, we identified 8 that reliably induced the differentiation signature, and furthermore yielded functional evidence of bona fide differentiation. This SuperSeries is composed of the following subset Series:; GSE976: Gene Expression-Based High Throughput Screening: APL Treatment with Candidate Compounds; GSE982: Gene Expression-Based High Throughput Screening: HL-60 Cell Treatment with Candidate Compounds; GSE983: Gene Expression-Based High Throughput Screening: Primary Patient AML Blasts, Normal Neutrophils, and Normal Monocytes; GSE985: Gene Expression-Based High Throughput Screening: HL-60 Cells Treated with ATRA and PMA Experiment Overall Design: Refer to individual Series
2007-09-20 | E-GEOD-995 | biostudies-arrayexpress