Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
Ontology highlight
ABSTRACT:
OTHER RELATED OMICS DATASETS IN: PRJNA125701
ORGANISM(S): Arabidopsis thaliana Turnip mosaic virus
PROVIDER: GSE20197 | GEO | 2010/04/09
SECONDARY ACCESSION(S): PRJNA125701
REPOSITORIES: GEO
Similar Datasets
Project description:Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
| PRJNA125701 | ENA
Project description:AGO protein immunoprecipitation was combined with high-throughput sequencing of associated small RNAs. AGO2, AGO10, and to a lesser extent AGO1 were shown to associate with siRNAs derived from silencing suppressor (HC-Pro)-deficient TuMV-AS9, but not with siRNAs derived from wild-type TuMV. Co-immunoprecipitation and small RNA sequencing revealed that viral siRNAs broadly associated with wild-type HC-Pro during TuMV infection. These results support the hypothesis that suppression of antiviral silencing during TuMV infection, at least in part, occurs through sequestration of virus-derived siRNAs away from antiviral AGO proteins by HC-Pro. Catalytic mutant HA-AGO1-DAH, HA-AGO2-DAD and HA-AGO10-DAH or catalytically active HA-AGO10-DDH were immunoprecipitated from buffer (mock) or inoculated rosette leaves (at 7 dpi) or noninoculated cauline leaves at 10 dpi with wt TuMV or suppressor-deficient TuMV-AS9. Inflorescence from TuMV infected plants was collected at 10 dpi with wt TuMV. HC-Pro was tagged with 6xHIS in TuMV-HIS and suppressor-deficient TuMV-HIS-AS9. HC-Pro was immunoprecipitated from noninoculated cauline leaves of inflorescence at 10 dpi. HC-Pro AS9 was immunoprecipitated from noninoculated cauline leaves at 15 dpi. Total RNA was extracted from input fraction and small RNAs separated by size fractionation. Small RNAs in input and HA-AGO or HC-Pro immunoprecipitation fractions were converted to DNA Amplicons by 5' (GUUCAGAGUUCUACAGUCCGACGAUC) or 3’ (CTGTAGGCACCATCAAT) adaptor ligation followed by RT-PCR. DNA Amplicons were sequenced using the Illumina HiSeq2000 platform. Duplicate libraries were made per treatment. For each library, hits to TuMV, to TuMV-HIS and to Arabidopsis thaliana were included in separate files.
2015-04-06 | E-GEOD-64911 | biostudies-arrayexpress
Project description:Arabidopsis ecotype Col-0 expressing RPL18 fused to His & Flag epitopes (RPL18-HF) under 35S control was used to discern the effects of Turnip mosaic virus (TuMV) infection on host translation initiation. Plants were grown in LC-1 soil in 12 hour days and infected by TuMV-GFP or mock-inoculated just prior to sending up bolts. Samples were taken from rosette leaves 10 days after inoculation. Only tissue fluorescing GFP was selected from the virus-infected samples. Similar tissue was sampled from mock-infected leaves. FLAG antibody was used to isolate RPL18-HF. The RNA co-immunoprecipitated with RPL18-HF is fully translation-initiated. This translation-initiated RNA, also referred to as polysomal RNA, was isolated and compared to total RNA under both mock and TuMV-infected states to find TuMV-induced changes in host translation initiation. ****[PLEXdb(http://www.plexdb.org) has submitted this series at GEO on behalf of the original contributor, Jackson Moeller. The equivalent experiment is AT42 at PLEXdb.] pathogen infection: TuMV inoculated - RNA fraction: polysomal RNA(3-replications); pathogen infection: TuMV inoculated - RNA fraction: total RNA(3-replications); pathogen infection: mock inoculated - RNA fraction: polysomal RNA(3-replications); pathogen infection: mock inoculated - RNA fraction: total RNA(3-replications)
2011-03-11 | E-GEOD-20278 | biostudies-arrayexpress
Project description:Arabidopsis ecotype Col-0 expressing RPL18 fused to His & Flag epitopes (RPL18-HF) under 35S control was used to discern the effects of Turnip mosaic virus (TuMV) infection on host translation initiation. Plants were grown in LC-1 soil in 12 hour days and infected by TuMV-GFP or mock-inoculated just prior to sending up bolts. Samples were taken from rosette leaves 10 days after inoculation. Only tissue fluorescing GFP was selected from the virus-infected samples. Similar tissue was sampled from mock-infected leaves. FLAG antibody was used to isolate RPL18-HF. The RNA co-immunoprecipitated with RPL18-HF is fully translation-initiated. This translation-initiated RNA, also referred to as polysomal RNA, was isolated and compared to total RNA under both mock and TuMV-infected states to find TuMV-induced changes in host translation initiation. ****[PLEXdb(http://www.plexdb.org) has submitted this series at GEO on behalf of the original contributor, Jackson Moeller. The equivalent experiment is AT42 at PLEXdb.]
2011-03-11 | GSE20278 | GEO
Project description:The main purpose of Part A of the study is to evaluate safety, tolerability and tracer uptake after a single intravenous (IV) administration of [68Ga]Ga-DPI-4452; Part B: is to determine the recommended phase 2 dose (RP2D) [maximum tolerated dose (MTD) or lower dose] for [177Lu]Lu-DPI-4452 for each tumor type; Part C: is to evaluate the preliminary antitumor activity of [177Lu]Lu-DPI-4452 as monotherapy.
| 6652 | ecrin-mdr-crc
Project description:In Arabidopsis thaliana, the immediate early response of plants to cytokinin is formulated as the multistep AHK-AHP-ARR phosphorelay signaling circuitry, which is initiated by the cytokinin-receptor histidine protein kinases. In the hope of finding components (or genes) that function downstream of the cytokinin-mediated His-Asp phosphorelay signaling circuitry, we carried out genome-wide microarray analyses. To this end, we focused on a pair of highly homologous ARR10 and ARR12 genes by constructing an arr10 arr12 double null mutant. The mutant alleles used in this study were arr10-5 and arr12-1. arr10-5 is the SALK_098604 T-DNA insertion line, whose mutation was determined to be located in the fifth exon of the ARR10 coding sequence. Arr12-1 is the SALK_054752 T-DNA insertion line, whose mutation was determined to be located in the third exon of the ARR12 coding sequence. The resulting mutant exhibits a characteristic phenotype with regard to the cytokinin-mediated His-Asp phosphorelay. Here we, therefore, compared response to cytokinin in wild type with that in arr10 arr12 double mutant. In this study, wild type and the arr10 arr12 double mutant grown vertically on MS agar plates for 2 weeks were treated with 20uM t-zeatin or 0.02% DMSO (solvent for t-zetion solution) for 1h. These treated plant samples were divided into three portions, from which RNA samples were prepared separately from aerial parts of seedlings with use of RNeasy Plant Mini Kit (Qiagen, Valencia, CA, U.S.A.). The Quality of RNAs prepared was analyzed by Bioanalyzer 2100 (Agilent Technologies). These RNA samples were processed as recommended by the Affymetrix instruction (Affymetrix GeneChip Expression Analysis Technical Manual, Affymetrix). These dataset will provide us with bases for understanding the early response to cytokinin on aerial parts of seedlings in Arabidopsis thaliana. Experimenter name: Hitoshi SAKAKIBARA Experimenter phone: 81455039576 Experimenter fax: 81455039609 Experimenter address: Biodynamics Research Team Experimenter address: RIKEN Plant Science Center Experimenter address: 1-7-22 Suehiro, Tsurumi Experimenter address: Yokohama Experimenter zip/postal_code: 230-0045 Experimenter country: JAPAN Keywords: compound_treatment_design;
2007-01-22 | GSE6832 | GEO
Project description:To better examine the molecular mechanisms behind the virus infection, we conducted a correlation analysis of RNA-Seq and quantitative iTRAQ-LC-MS/MS in TuMV-infected and in healthy Chinese cabbage leaves.
2020-08-07 | GSE151932 | GEO
Project description:We report the application of single cell RNA sequencing technology for high-throughput profiling of sham and 3 dpi spinal cords in mice. By obtaining a total of 16051 cells from sham and 14295 cells from 3 dpi tissue, we identified 26 distinct cell clusters and 11 major cell types expressing known markers. These clusters comprised oligodendrocytes (Mbp, Mobp, Mog, Plp1), microglia (Gpr84, Cx3cr1, Csf1r), astrocytes (Gpr37l1, Bcan, Gfap), neutrophils (S100a9, Mmp9, S100a8), fibroblasts (Col1a1, Col1a2, Dcn), pericytes (Pdgfrb, Rgs5), endothelial cells (Flt1, Pecam1, Egfl7), macrophages (Ms4a7), monocytes (Ccr2, Cxcl3), b cells (CD19) and t cells (CD3e). neurons were not included because they were not expected to fit the sequencing protocol. We found that the most abundant cell type in the sham group was oligodendrocytes, accounting for 46.12%, while it decreased to 15.9% in the 3 dpi group. The second was microglia, accounting for 22.41%, which increased in number in the 3 dpi group, making it the most abundant cell in the SCI 3 dpi tissue (26.65%). The number of astrocytes also increased to 9.24% after SCI. Foreign immune cells such as neutrophils, macrophages, and monocytes accounted for 11.15%, 17.74%, and 9.41% of all cells after SCI, respectively. Among these, the percentage of pericytes decreased from 8.64% in the sham group to 1.28% in the 3 dpi group. The number of fibroblasts varied dramatically, rising rapidly from 0.33% in the sham group to 5.65% in the SCI 3 dpi group (Figure 2B). This study provides a framework for the application of single cell sequencing towards characterization of diverse cell populations in the sham and 3 dpi spinal cord.
2022-04-30 | GSE201652 | GEO
Project description:Men are at an increased risk of dying from heart failure caused by inflammatory heart diseases such as atherosclerosis, myocarditis and dilated cardiomyopathy (DCM). We previously showed that immune responses in the heart are phenotypically distinct in male compared to female mice 10 days after infection resulting in severe DCM in males. Groups consisted of Infected Males, Infected Females, Uninfected Males and Uninfected females. There are 3 mice per group. A total of 12 samples were analyzed in this experiment (12 for 10 dpi and 12 for 90 dpi).
2012-01-19 | E-GEOD-35182 | biostudies-arrayexpress
Project description: Not available
| S-EPMC5671917 | biostudies-literature