Genes regulated by Sox2 in colorectal cancer cell line
Ontology highlight
ABSTRACT:
ORGANISM(S): Homo sapiens
PROVIDER: GSE20689 | GEO | 2011/03/01
SECONDARY ACCESSION(S): PRJNA125001
REPOSITORIES: GEO
Similar Datasets
Project description:Knockdown of Sox2 in SW620 colorectal cancer cells decrease their growth rates in vitro and in vivo in xenograft models. We used microarrays to detail the global programme of gene expression in Sox2 Knockdown sw620 cells compared with mock knockdown sw620 cells Sox2 knockdown sw620 cells and and mock knockdown sw620 cells were cultured in RPMI 1640 cell culture media for RNA extraction and hybridization on Affymetrix microarrays. We sought to obtain the genes regulated by Sox2 in colorectal cell lines and end (T4) of gastrulation.
2011-03-01 | E-GEOD-20689 | biostudies-arrayexpress
Project description:Knockdown of Sox2 in LN229 gliomal cancer cells decrease their growth rates in vitro. We used microarrays to detail the global programme of gene expression in Sox2 Knockdown LN229 cells compared with mock knockdown LN229 cells
2011-01-10 | GSE23838 | GEO
Project description:Knockdown of Sox2 in LN229 gliomal cancer cells decrease their growth rates in vitro. We used microarrays to detail the global programme of gene expression in Sox2 Knockdown LN229 cells compared with mock knockdown LN229 cells Sox2 knockdown LN229 cells and and mock knockdown LN229 cells were cultured in DMEM cell culture media for RNA extraction and hybridization on Applied Biosystems Human Genome Survey Microarrays . We sought to obtain the genes regulated by Sox2 in glioma cell line.
2011-01-10 | E-GEOD-23838 | biostudies-arrayexpress
Project description:The pluripotency transcription factor SOX2 is essential for the maintenance of glioblastoma stem cells (GSC), which drive tumor growth and treatment resistance.To understand how SOX2 is regulated in GSCs, we utilized a proteomic approach and identified the E3 ubiquitin ligase TRIM26 as a direct SOX2-interacting protein. Unexpectedly, we found TRIM26 depletion decreased SOX2 protein levels and increased SOX2 polyubiquitination in patient-derived GSCs, suggesting TRIM26 promotes SOX2 protein stability. Accordingly, TRIM26 knockdown reduced SOX2 transcriptional activity, self-renewal capacity, and in vivo tumorigenicity in multiple GSC lines. Mechanistically, we found TRIM26, via its C-terminal PRYSPRY domain, but independent of its RING domain, stabilizes SOX2 protein by directly inhibiting the interaction of SOX2 with WWP2, which we identify as a bona fide SOX2 E3 ligase in GSCs. Our work identifies E3 ligase competition as a critical mechanism of SOX2 regulation, with functional consequences for GSC identity and maintenance.
2021-11-04 | PXD028933 | Pride
Project description:Sox2 has been studied in several types of human solid tumors. The investigators found that Sox2 had higher expression level in colorectal cancer and metastatic tissues than normal tissues. So the investigators assumed that whether Sox2 plays an important role in the progression and migration of colon cancer.
| 2124687 | ecrin-mdr-crc
Project description:Making use of a previously described isogenic cancer stem cells and serum differentiated cultures we show that Sox2 controls developmental stated specific programs in glioblastoma. Glioblastoma cells were cultured as control and with SOX2 knockdown to identify the scope of SOX2 interactions. The SOX2 knockdown were accomplished using two knockdown technologies. The knockdown cells were compared to controls, early passage, and scrambled controls. For Sox2 knockdown in low passage 10% FBS cells, the following oligonucleotides targeting human SOX2 coding sequence, or non-silencing control sequence, were cloned into BLOCK-iT Pol II miR RNAi expression vectors (Invitrogen), before cell transfection into GBM monolayer cells using Lipofectamine-2000 (Invitrogen): Sox2miRNA1R:5’CCTGTGCATGGGCTGTCTGCGCTGTCAGTCAGTGGCCAAAACAGCGCAGATGCAGCCCATGCAC Sox2miRNA1F:5’TGCTGTGCATGGGCTGCATCTGCGCTGTTTTGGCCACTGACTGACAGCGCAGACAGCC Sox2miRNA2R:5’CCTGAACCCATGGAGAAGAGCCAGTCAGTCAGTGGCCAAAACTGGCTCTTGGCTCCATGGGTTC Sox2miRNA2F:5’TGCTGAACCCATGGAGCCAAGAGCCAGTTTTGGCCACTGACTGACTGGCTCTTCTCCATGGGTT miRNAnegative:5’GAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCACGCAGTACATTT Sox2 knockdown in neurospheres: GIPZ Lentiviral shRNAmir constructs targeting human Sox2 (clones V3LHS_404430 and V3LHS_404432) and non-silencing control (RHS4346) were obtained (Thermo Scientific Open Biosystems) and lentivirus were prepared according to the manufacturer’s instructions. Sox2 ectopic expression: Sox2 cDNA was subcloned from pCMV6-XL5-NM_002106.2 (Origene) into pcDNA 3.1 mammalian expression vector (Invitrogen), under control of constitutive CMV promoter. Plasmid DNA constructs were stably transfected into GBM monolayer cells using Lipofectamine-2000 (Invitrogen). Control Glioblastoma cells cultured as neurospheres and monolayer early passage are compared to multiple shRNA SOX2 knockdown and multiple miR knockdown cell cultures. A total of 8 samples are analyzed for significant fold change genes identifying gene-gene interactions associated with the SOX2 knockdown. High fold change genes are grouped in lists to be analyzed for network-pathway enrichment. Overlap of significant gene list for each method were analyzed.
2014-07-22 | E-GEOD-51441 | biostudies-arrayexpress
Project description:Making use of a previously described isogenic cancer stem cells and serum differentiated cultures we show that Sox2 controls developmental stated specific programs in glioblastoma. Glioblastoma cells were cultured as control and with SOX2 knockdown to identify the scope of SOX2 interactions. The SOX2 knockdown were accomplished using two knockdown technologies. The knockdown cells were compared to controls, early passage, and scrambled controls. For Sox2 knockdown in low passage 10% FBS cells, the following oligonucleotides targeting human SOX2 coding sequence, or non-silencing control sequence, were cloned into BLOCK-iT Pol II miR RNAi expression vectors (Invitrogen), before cell transfection into GBM monolayer cells using Lipofectamine-2000 (Invitrogen): Sox2miRNA1R:5’CCTGTGCATGGGCTGTCTGCGCTGTCAGTCAGTGGCCAAAACAGCGCAGATGCAGCCCATGCAC Sox2miRNA1F:5’TGCTGTGCATGGGCTGCATCTGCGCTGTTTTGGCCACTGACTGACAGCGCAGACAGCC Sox2miRNA2R:5’CCTGAACCCATGGAGAAGAGCCAGTCAGTCAGTGGCCAAAACTGGCTCTTGGCTCCATGGGTTC Sox2miRNA2F:5’TGCTGAACCCATGGAGCCAAGAGCCAGTTTTGGCCACTGACTGACTGGCTCTTCTCCATGGGTT miRNAnegative:5’GAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCACGCAGTACATTT Sox2 knockdown in neurospheres: GIPZ Lentiviral shRNAmir constructs targeting human Sox2 (clones V3LHS_404430 and V3LHS_404432) and non-silencing control (RHS4346) were obtained (Thermo Scientific Open Biosystems) and lentivirus were prepared according to the manufacturer’s instructions. Sox2 ectopic expression: Sox2 cDNA was subcloned from pCMV6-XL5-NM_002106.2 (Origene) into pcDNA 3.1 mammalian expression vector (Invitrogen), under control of constitutive CMV promoter. Plasmid DNA constructs were stably transfected into GBM monolayer cells using Lipofectamine-2000 (Invitrogen).
2014-07-22 | GSE51441 | GEO
Project description:Esrrb, Sox2 or Esrrb and Sox2 were knocked down in mouse ES cells using shRNA plasmid pSUPER.puro containing shRNAs from the publications Feng et al., 2009 and Rodda et al., 2005. Knockdown was transfected into mouse ES cells using lipofectamine and then cells were selected for knockdown using puromycin. RNA was harvested after 2 days of knockdown. Esrrb and Sox2 were knocked down in mouse ES cells either individually or together, cells were selected with puromycin and RNA harvested and subjected to microarray after 2 days.
2012-11-22 | E-GEOD-34170 | biostudies-arrayexpress
Project description:MS analysis of proteins from FUT8-knockdown SW480 and SW620 colorectal cancer cells
2024-03-21 | PXD050012 | Pride
Project description:Esrrb, Sox2 or Esrrb and Sox2 were knocked down in mouse ES cells using shRNA plasmid pSUPER.puro containing shRNAs from the publications Feng et al., 2009 and Rodda et al., 2005. Knockdown was transfected into mouse ES cells using lipofectamine and then cells were selected for knockdown using puromycin. RNA was harvested after 2 days of knockdown.
2012-11-22 | GSE34170 | GEO