Dataset Information

Exosomes targeting Myc reverse the proneural-mesenchymal transition and extend the survival of end-stage glioblastoma mice

ABSTRACT: Exosomes generated from human bone marrow Mesenchymal Stem cells (MSC) and engineered to encapsulate different anti-Myc siRNAs (iExo-Myc) and scramble-siRNAs (iExo-Scr) were administered via retro-orbital injection to mice harboring late stage intracranial U87 tumor xenografts. Tumor growth and survival were monitored, and tumor xenografts were collected and transcriptionally profiled. Next, we performed gene expression profiling analysis using data obtained from RNA-seq of U87 tumor xenografts collected at the endpoint of the survival study from 3 iExo-Myc#1 treated mice and 4 iExo-Scr#1 treated mice

ORGANISM(S): Homo sapiens

PROVIDER: GSE207452 | GEO | 2024/04/11

REPOSITORIES: GEO

ACCESS DATA

Similar Datasets

Project description:Purpose: We identified KPC1 as the ubiquitin ligase that binds to the p105 precursor of NF-kB, ubiquitinates it and mediates its proteasomal processing to generate the p50 active subunit of the transcription factor. Using U87-MG human glioblastoma xenografts, we observed that overexpression of KPC1 results in strong inhibition of tumor growth mediated via excessive generation of p50.The goal of this RNASeq study was to analyze the profile of gene expression in xenografts overexpressing control (V0), KPC1 or p50 vectors, and to further understand how the altered gene expression patterns can explain the tumor suppressive effect we observed. Results:Transcript analysis of U87-MG xenografts overexpressing control (V0), KPC1 or p50 vector mapped to the human genome revealed: • A strong similarity between overexpression of p50 and KPC1 (correlation of 0.51, p-value<10-300 ) • A specific signature of NF-kB targets [21 of the consistently changed genes are known to be regulated by NF-kB (p-value<3.4×10-9 )] • A significant (p-value<1.4×10-18) increase in the expression of 40 tumor suppressor genes, with no significant change in other classes. • A significant down regulation of a cluster of genes including LIN28B, IL-6, HMAGA2 and VEGFA. This finding links well to an established regulatory axis involving LIN28B, Let-7 microRNA, and IL-6 in inflammation and cell transformation that is regulated by NF-kB. Exponentially growing U87-MG cells were stably transfected with an empty vector (V0) or vectors coding for Myc-KPC1 or Flag-p50. Cells were dissociated with trypsin, washed with PBS, and brought to a concentration of 50×10^6 cells/ml. Cell suspension (5×10^6/0.1 ml) was inoculated subcutaneously at the right flank of 7-weeks old male Balb/C nude mice (n=7). Following 21 days, mRNA from U87-MG xenografts was isolated using an RNA purification kit, and analyzed using the Illumina HiSeq 2500 sequencer. The RNASeq analysis experiment was repeated twice independently. Run1 included a total of 7 samples. Samples 1-3 were isolated from V0 – control tumors (3 different tumors), samples 4-5 were isolated from KPC1-expressing tumors (2 different pools of 3 tumors each due to small tumor size), and samples 6-7 were isolated from p50-expressing tumors for (2 different pools of 2-3 tumors each, due to very small tumor size). Run2 included a total of 5 samples. Samples 8-10 were isolated from V0 (control) tumors (3 different tumors), samples 11-12 were isolated from KPC1 tumors (2 different pools of 3 tumors each due to small tumor size). Several repeated attempts to extract RNA from the p50-expressing tumors did not yield any results, as the tumors were miniscule.

Project description:CCAT1-L is a highly expressed long noncoding RNA located in the colorectal cancer specific super enhance region about 500 kb upstream of MYC gene. Knockdown of CCAT1-L significantly down-regulated interaction frequency between CCAT1 and MYC locus and repress MYC expression, suggesting a long-range chromatin interaction between CCAT1-L and MYC locus maintained by CCAT1-L underlie the MYC regulation. To further validate this hypothesis, multiplexed 3C sequencing (3C-seq) was employed to evaluate chromatin interaction strength between CCAT1-L and MYC locus in CCAT1-L knockdown and scramble knockdown (Scr) HT29 cells. The 3C-Seq design and data analysis were performed according to Stadhouders et al, Nat Protoc. 2013, 8:509-524. A series of bait sequences accommodating different locus around CCAT1-L and MYC were selected. Through integrating with specific sample barcodes, bait-specific primer sets were designed to construct relevant 3C-seq libraries in CCAT1-L knockdown and scramble knockdown (Scr) HT29 samples. All of the 3C sample libraries from different treatment, including CCAT1-L knockdown and scramble knockdown (Scr), were then pooled together for high-throughput sequencing. Two technical 3C-seq were performed (CCAT1_myc_3C_1.txt.gz and CCAT1_myc_3C_2.txt.gz) and then combined together to get enough reads for further analysis. 3C-seq reads from different samples were divided according to sample barcodes (CCAT1-L knockdown: ATGTCA; Scr: GCCAAT) and different bait sequences, and then mapped to human reference genome to assess chromatin interaction strength between CCAT1-L and MYC locus in different treatments. In our study, one representative bait-specific sequencing data (CTTCTACTGATTGGCCCTAAACACTTTTCCAAAGCTT) was select to generate bedgraph files and upload to UCSC for visualization to show the chromatin interaction between CCAT1-L and Myc locus in CCAT1-L knockdown (CCAT1-L_knockdown_out.bedgraph) and scramble knockdown (Scr_out.bedgraph) samples.

Dataset Information

Exosomes targeting Myc reverse the proneural-mesenchymal transition and extend the survival of end-stage glioblastoma mice

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure