Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Genome-wide occupancy of CNBP and SMARCC2 in neuroblastoma cells.

ABSTRACT: Neuroblastoma (NB), a malignant embryonic tumor arising from primitive neural crest cells, accounts for more than 7% of malignancies and around 15% of cancer-related mortality in childhood. Better elucidating the mechanisms of tumorigenesis and aggressiveness is important for improving the therapeutic efficiencies of NB. Through integrated proteomics and validating studies, we discovered that CNBP physically interacted with SMARCC2 in NB cells. To investigate the mechanisms underlying the functions of CNBP and SMARCC2, we employed the Illumina Novaseq 6000 as a discovery platform to analyze the genome-wide occupancy of CNBP and SMARCC2 on target genes in human IMR-32 cells, while the results were further analyzed with CNBP-regulated target genes. The results showed that CNBP repressed the enrichment of SMARCC2 on 124 target genes, especially those involved in ribosome biogenesis, including BYSL, NOP58, and RRP9. Furthermore, we validated the ChIP-seq results by real-time PCR with high identity. Overall, our results provided fundamental information about the genomic enrichment of CNBP and SMARCC2 in human NB cells, and these findings will help us understand the pathogenesis of NB.

ORGANISM(S): Homo sapiens

PROVIDER: GSE215795 | GEO | 2023/08/07

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Similar Datasets

Transcriptomic analysis of neuroblastoma cells in response to stable over-expression of cellular nucleic acid binding protein (CNBP)

Project description:Cellular nucleic acid binding protein (CNBP) is a 19 kDa conserved protein containing seven tandem cysteine-cysteine-histidine-cysteine zinc finger repeats. However, the action modes and underlying mechanisms of CNBP in NB progression remain largely unknown. We identify CNBP as an independent prognostic factor for poor outcome of neuroblastoma. CNBP exerts oncogenic roles in ribosome biogenesis, tumorigenesis, and aggressiveness. To investigate the mechanisms underlying the oncogenic functions of CNBP, we employed the Illumina HiSeq X Ten as a discovery platform to analyze the transcriptome profiling changes of human neuroblastoma IMR-32 cells in response to stable over-expression of CNBP. The results showed that stable over-expression of CNBP led to altered expression of 3524 human mRNAs, including 889 up-regulated genes and 2635 down-regulated genes. Furthermore, we validated the RNA-seq results by real-time RT-PCR with high identity. Overall, our results provided fundamental information about the transcriptomic changes in response to CNBP over-expression in human tumor cells, and these findings will help us understand the pathogenesis of tumor progression.

2023-05-03 | GSE215748 | GEO

Project description:CRISPR Off-target enrichment results

| PRJNA633033 | ENA

Neuroblastoma cell lines treated with DAC (2'-deoxy-5-azacytidine), a DNA-methylation inhibitor

Project description:8 neuroblastoma (NB) cell lines (CLB-GA, IMR-32, SH-SY5Y, N206, CHP-902R, LAN-2, SK-N-AS, SJNB-1) were profiled on the Affymetrix HGU-133plus2,0 platform before and after treatment with DAC (2'-deoxy-5-azacytidine) to investigate the influence on expression after inhibiting DNA-methylation 8 NB cell lines were included (CLB-GA, IMR-32, SH-SY5Y, N206, CHP-902R, LAN-2, SK-N-AS, SJNB-1), before and after treatment with 3 micromolars of DAC for 3 days

2012-09-13 | E-GEOD-31229 | biostudies-arrayexpress

Methylation map of 8 neuroblastoma cell lines: NGS after MBD2-capture

Project description:8 neuroblastoma (NB) cell lines (CLB-GA, IMR-32, SH-SY5Y, N206, CHP-902R, LAN-2, SK-N-AS, SJNB-1) their methylome is determined by sequencing after MBD2-capture using MethylCollector (ActiveMotif) 8 NB cell lines were included (CLB-GA, IMR-32, SH-SY5Y, N206, CHP-902R, LAN-2, SK-N-AS, SJNB-1) in this study. After shearing (fragments of about 200 bp), DNA was captured using MBD2-capture (MethylCollector - ActiveMotif) followed by library preparation and multiplexing. Captured sequence tags were sequenced paired-end (2 x 45 bp) on Illumina GAIIx.

2012-09-13 | E-GEOD-31353 | biostudies-arrayexpress

Methylation map of 8 neuroblastoma cell lines: NGS after MBD2-capture

2012-09-13 | GSE31353 | GEO

Genome-wide occupancy of ZRF1 and BRD4 in neuroblastoma cells.

Project description:Neuroblastoma (NB), a malignant embryonic tumor arising from primitive neural crest cells, accounts for more than 7% of malignancies and around 15% of cancer-related mortality in childhood. Better elucidating the mechanisms of tumorigenesis and aggressiveness is important for improving the therapeutic efficiencies of NB. Through integrated proteomics and validating studies, we discovered that ZRF1 and BRD4 form a complex with p113, a novel protein derived from CUX1 circular RNA. To investigate the mechanisms underlying the oncogenic functions of ZRF1 and BRD4, we employed the Illumina Novaseq 6000 as a discovery platform to analyze the genome-wide occupancy of ZRF1 and BRD4 on target genes in human SH-SY5Y cells, while the results were further analyzed with p113-regulated target genes. The results showed that 46 target genes were regulated by transcriptional trimer complex p113/ZRF1/BRD4, especially those involved in metabolic pathway or complex I biogenesis, including ALDH3A1, NDUFA1, and NDUFAF5. Furthermore, we validated the ChIP-seq results by real-time PCR with high identity. Overall, our results provided fundamental information about the genomic enrichment of ZRF1 and BRD4 in human NB cells, and these findings will help us understand the pathogenesis of NB.

2021-10-06 | GSE182402 | GEO

Genome-wide profiling of mature piRNAs in human Neuroblastoma (NB) cell lines

Project description:To elucidate potential role of piRNAs in Neuroblastoma (NB), we performed the genome wide profiling in two human NB cell lines, IMR-32 and SH-SY-5Y by adopting high-throughput RNA sequencing (RNA-Seq) and unveil their possible functions in neoplastic pathways. The RNA sequencing results revealed both known and novel piRNAs in both the cell lines. We observed a total 630 annotated mature piRNAs, distributed across chromosomes and mitochondria which were mapped to various genomic locations such as introns, protein coding regions, repeats, pseudogenes, ncRNAs etc. This is the first study reporting the extensive catalogue of human NB piRNAs which will provide a useful resource to dissect complex neoplastic events that are possibly mediated by piRNAs in neuroblastoma. Moreover, these piRNAs could be used as probable small RNA biomarkers for the Neuroblastoma.

2018-03-20 | GSE83945 | GEO

Neuroblastoma cell lines treated with DAC (2'-deoxy-5-azacytidine), a DNA-methylation inhibitor

2012-09-13 | GSE31229 | GEO

mRNA expression profiles of TAE-684 treated or shALK transfected neuroblastoma cell lines

Project description:Human wild-type ALK (SK-N-AS, NGP, IMR-32), ALKR1275Q (CLB-GA, LAN-5, UKF-NB-3), ALKF1174L (SK-N-SH, Kelly, SMS-KCNR) and ALK amplified (NB-1) neuroblastoma cell lines were treated in triplicate with 0.3M-k_M NPV-TAE-684 (Novartis/SelleckChem) or DMSO (VWR) for 6 hours, followed by RNA isolation and gene expression profiling. For shRNA mediated knockdown, pGIPZ-ALK shRNAmir and pGIPZ-non-silencing control shRNAmir vectors were used (Open Biosystems). The ALK shRNA was directed against a part of exon 26 in the tyrosine kinase domain of ALK (target sequence: TGGAAGGAATATTCACTTCTAA). Lentiviral particles were produced according to manufacturerM-^IM-[M-*s protocol (Open Biosystems). On day 2 post-transduction of neuroblastoma cells, the transduction efficiency was determined by flow cytometry and microscopic analysis of GFP-positive cells (>90% so no further selection was performed). Cells were subsequently harvested for expression profiling. Labeling of the RNA samples and hybridisation to the Affymetrix HG-U133plus2 arrays was performed using the manufacturerM-^IM-[M-*s protocol starting from 1 M-eM-5g of RNA.

2015-05-04 | E-MTAB-3205 | biostudies-arrayexpress

NOPCHAP1 is a PAQosome cofactor that helps loading NOP58 on RUVBL1/2 during box C/D snoRNP biogenesis

Project description:The PAQosome is a large complex composed of the HSP90/R2TP chaperone and a prefoldin-like module. It promotes the biogenesis of cellular machineries but it is unclear how it discriminates closely related client proteins. Among the main PAQosome clients are C/D snoRNPs and in particular their core protein NOP58. Using NOP58 mutants and proteomic experiments, we identify different assembly intermediates and show that C12ORF45, which we rename NOPCHAP1, acts as a bridge between NOP58 and PAQosome. NOPCHAP1 makes direct physical interactions with the CC-NOP domain of NOP58 and domain II of RUVBL1/RUVBL2 AAA+ ATPases. Interestingly, NOPCHAP1 interaction with RuvBL1/2 is disrupted upon ATP binding. Moreover, while it robustly binds both yeast and human NOP58, it makes little interactions with NOP56 and PRPF31, two other closely related CC-NOP proteins. Expression of NOP58, but not NOP56 or PRPF31, is decreased in NOPCHAP1 KO cells. We propose that NOPCHAP1 is a client-loading PAQosome cofactor that selects NOP58 to promote box C/D snoRNP assembly.

2020-12-11 | GSE161155 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data