GiRAFR improves gRNA detection and annotation in single cell CRISPR screens
Ontology highlight
ABSTRACT:
ORGANISM(S): Homo sapiens
PROVIDER: GSE216040 | GEO | 2023/09/29
REPOSITORIES: GEO
Similar Datasets
Project description:Background: The CRISPR/Cas9 toolbox has recently been expanded to include approaches for modulating gene expression. To successfully build on this work, and apply it for answering biological questions, it is important to establish it in a broad range of circumstances. Genome-scale CRISPR interference (CRISPRi) has been used in human cells lines, however the rules for designing effective guide RNAs (gRNAs) in different organisms are not well known. We sought to determine rules that determine gRNA effectiveness at transcriptional repression in Saccharomyces cerevisiae. Results: We created an inducible single plasmid CRISPRi system for gene repression in yeast, and used it to analyze fitness effects of gRNAs under 18 small molecule treatments. Our approach correctly identified previously-described chemical-genetic interactions, as well as a new mechanism of suppressing fluconazole toxicity by repression of the ERG25 gene. Assessment of multiple target loci across treatments allowed us to determine generalizable features associated with gRNA efficacy. Guides that target regions with low nucleosome occupancy and high chromatin accessibility were clearly more effective. We also found the best region to target gRNAs was between the transcription start site (TSS) and 200bp upstream of the TSS. Finally, unlike nuclease-proficient Cas9 in human cells, point mutations were tolerated equally well by truncated (18 nt specificity sequence) and full length (20 nt) gRNAs, however, 18 nt gRNAs were generally less potent than full length gRNAs. Conclusions: Our results establish a powerful functional genomics screening method, provide rules for designing effective gRNAs for gene repression, and show that 18 nt and 20 nt gRNAs exhibit similar tolerance to mismatches in the target sequence. These findings will enable effective library design and genome-wide screening in many genetic backgrounds. An expression construct was created for inducible CRISPRi in yeast. Key features include ORFs expressing dCas9-Mxi1 and the tetracycline repressor (TetR), as well as a tetracycline inducible gRNA locus containing the RPR1 promoter with a TetO site, a NotI site for cloning new gRNA specificity sequences, and the constant part of the gRNA. When yeast containing this plasmid are grown in the absence of anhydrotetracycline (ATc) TetR binds the gRNA promoter and prevents PolIII from binding and transcribing the gRNA. This in turn prevents dCas9-Mxi1 from binding the target site. In the presence of ATc, TetR dissociates and gRNA is expressed, allowing dCas9-Mxi1 to bind its target locus, and repress gene expression. gRNA libraries were cloned into this construct and transformed into yeast to create pools. Experiments were conducted in which yeast pools were grown in inducing (+ATc) and non-inducing conditions (-ATc) in the presence of different drugs. After multiple generations of growth in these conditions, yeast plasmids were minipreped and the gRNA locus was PCRed and sequenced via MiSeq. Counts of each gRNA were compared in different conditions.
2016-01-18 | E-GEOD-71490 | biostudies-arrayexpress
Project description:We combined CRISPR genome editing with single-cell RNA sequencing to assess complex phenotypes in pooled cellular screens. Our method for CRISPR droplet sequencing (CROP-seq) comprises four key components: a gRNA vector that makes individual gRNAs detectable in single-cell transcriptomes, a high-throughput assay for single-cell RNA-seq, a computational pipeline for assigning single-cell transcriptomes to gRNAs, and a bioinformatic method for analyzing and interpreting gRNA-induced transcriptional profiles. CROP-seq allowed us to link gRNA expression to the associated transcriptome responses in thousands of single cells using a straightforward and broadly applicable screening workflow. Additional information are available from the CROP-seq website http://crop-seq.computational-epigenetics.org
2017-01-18 | GSE92872 | GEO
Project description:Type VI CRISPR enzymes are RNA-targeting proteins with nuclease activity that enable specific and robust target gene knockdown without altering the genome. To define rules for the design of Cas13d guide RNAs, we conducted massively parallel screens targeting messenger RNAs of a green fluorescent protein transgene, and CD46, CD55 and CD71 cell-surface proteins in human cells. In total, we measured the activity of 24,460 gRNAs with and without mismatches relative to the target sequences. Knockdown efficacy is driven by gRNA-specific features and target site context. Single mismatches generally reduce knockdown to a modest degree, but spacer nucleotides 15–21 are largely intolerant of target site mismatches. We developed a computational model to identify optimal gRNAs and confirm their generalizability testing 3,979 guides targeting mRNAs of 48 endogenous genes. We show that Cas13 can be used in forward transcriptomic pooled screens and, using our model, predict optimized Cas13 gRNAs for all protein-coding transcripts in the human genome.
2020-01-30 | GSE142675 | GEO
Project description:RNA-Seq after Cas9-gRNA transfection with different length gRNAs we performed PolyA Selection and RNA-Seq on cells transfected with dCas9-VPR and a gRNA of each length (20nt, 16nt, or 14nt) targeting ACTC1, MIAT, or HBG1/2
2015-07-15 | E-GEOD-70694 | biostudies-arrayexpress
Project description:In this study, we demonstrate that CRISPR/RfxCas13d (CasRx)-mediated circRNA depletion is, for the circRNAs studied, more efficient than Argonaute 2-dependent short hairpin RNA (agoshRNA)-mediated depletion and with fewer off-target effects on the linear host RNAs. We also designed and optimally used synthetic guide RNAs (syn-gRNAs) in combination with CasRx to efficienctly deplete circRNA ciRS-7. None of the knockdown strategies tested (pre-gRNA, gRNA, syn-gRNA and agoshRNA) showed any significant off-target effects at the transcriptomics level. Differential expression analysis was performed for each KD setup versus non-targeting control (three biological replicates of each). In conclusion, CasRx-mediated circRNA knockdown using both vector-based and syn-gRNA strategies is a useful tool for future studies on circRNA functions.
2023-04-30 | GSE189963 | GEO
Project description:Cas9, a CRISPR RNA-guided nuclease, has been rapidly adopted as a tool for biochemical and genetic manipulation of DNA. Although Cas9 offers remarkable specificity and versatility for genome manipulation, mis-targeted events occur. To extend the understanding of Cas9 target::homology requirements, we compared mismatch tolerance for a specific Cas9::gRNA complex in vitro and in vivo (in Saccharomyces cerevisiae). A variety of truncated and full-length gRNAs (with 17, 18, and 20 nucleotides of complementarity sequence) were used. In each case, we observed notable differences between in vitro and in vivo Cas9 cleavage specificity profiles, with a more stringent effect of mismatches on activity seen in vivo. Increased specificity of the 18 nt complementarity truncated gRNA was evident in vivo, but not in vitro. Overall, this study highlights differences in the specificity of Cas9 cleavage between controlled in vitro conditions and complex and chromatinized in vivo conditions. We adapted a previous high throughput sequencing approach (doi: 10.1093/nar/gku1102) to assess the effects of single base variants in vivo. We used a polymorphic random variant library matched to a specific trigger sequence (for which we used a segment from the C. elegans unc-22 gene, previously designated âunc-22Aâ (doi: 10.1093/nar/gku1102). Cas9 in vivo and in vitro assays were carried out with four different gRNAs incorporating sequence from the unc-22A trigger segment. The four segments incorporate 17 nt, 18 nt, 20 nt, and 20+G nt of unc-22A complementarity respectively. The retention is calculated based on PMID: 25399416. File names denote the experiment-> gRNAname_gRNAlength_(invitro or invivo)_(incubation or induction time)_IlluminaRunID.dat The files contain all normalized sequences in column one with their calculated retentions in column 2.
2016-06-10 | E-GEOD-79667 | biostudies-arrayexpress
Project description:Weaker CEBPA binding in the human than in the mouse genome is a general trait of the human genome across multiple biological conditions. Alu repeats carry strong CEBPA binding motifs, which compete with regulatory regions for CEBPA binding. To directly test this hypothesis, we attempted to overcome Alu competition by using, first, a CRISPR-dCas9 system in BLaER1 cells (Rapino et al. 2013). By promoting the recruitment of the inactive Cas9 to Alu regions with specific gRNAs targeting Alu repeats containing strong CEBPA motifs we protected them, hampering CEBPA binding to these regions. We tested the effect of two different paired gRNA constructs in two replicates and one control paired gRNA in two replicates. Second, we also further overexpressed CEBPA in human BLaER1 cells to overcome Alu competition. We tested two doses of CEBPA overexpression in two replicates and one control experiment in two replicates.
2023-05-01 | E-MTAB-12597 | biostudies-arrayexpress
Project description:Acute myeloid leukaemia (AML) continues to have a very high mortality and its treatment hasnot changed for more than 20 years.Here, we propose to apply genomic-wide screens to directly identify therapeutic vulnerabilitiesof AML using AML cells lines with pre-defined somatic mutations. Our studies will be basedon genome-wide CRISPR/CAs9 gRNA screens and will be used to identify drivers of drugresistance to standard chemotherapies.This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/
2015-02-03 | E-ERAD-335 | biostudies-arrayexpress
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
2015-03-04 | E-GEOD-61099 | biostudies-arrayexpress
Project description:We performed an experimental Cas13d-SARScov2 genome-wide screen to identify gRNAs that would allow Cas13d to degrade the viral RNA. We built mCherry reporter plasmids that express mCherry with a 3kb 3'UTR deriving from the SARScov2 genome. In total we designed 11 reporters covering the entire plus strand of the viral genome and 11 other reporters covering the entire minus strand. Each of the 22 mCherry reporter plasmids carries a U6 expression cassette containing a Cas13d gRNA that targets the 3'UTR of the mCherry reporter. Each reporter is represented by a pool of reporters each containing a different gRNA that targets mCherry 3'UTR for a total average of ~300 gRNA per 3'UTR. The entire pool of 22 reporters, each with a pool of ~300 different gRNAs constitutes a comprehensive set ~6,500 reporters (~ 6,500 different gRNAs) that allowed us to interrogate the entire SARScov2 plus and minus strand viral RNA for regions of vulnerability and targetability. In order to specifically interrogate Cas13d activity an remove the biases that would be introduced in the reporter expression by the presence of a large 3kb 3'UTR we used a case (presence of Cas13d) control (absence of Cas13d) design. Briefly, the ~6,500 reporters were lentiviral transduced in RKO cells, the cells were split in 2 populations, 1 population was transduced with Cas13d and the other serving as control did not. The population expressing Cas13d was FACS sorted in low mCherry (efficient gRNAs) and high mCherry (un-efficient gRNAs) in 2 biological replicates and the genomic DNA of these populations was extracted, gRNAs were PCR amplified and sequenced. For the population that did not express Cas13d, a low mCherry, one high mCherry and unsorted population were sequenced as control libraries.
2023-10-29 | E-MTAB-11111 | biostudies-arrayexpress