Cas9 off-target binding to the promoter of bacterial genes leads to silencing and toxicity [ChIP-Seq]
Ontology highlight
ABSTRACT:
ORGANISM(S): Escherichia coli
PROVIDER: GSE217004 | GEO | 2022/11/04
REPOSITORIES: GEO
Similar Datasets
Project description:Over the last decade, gene-silencing mediated by dCas9 binding to transcribed regions or their promoters, a strategy referred to as CRISPRi, has emerged as a powerful tool in bacterial genetics. While this strategy has already been broadly adopted, several studies have reported experimental setups in which dCas9 expression was toxic. In particular, guide RNAs that share specific PAM-proximal sequence motifs were shown to be toxic to E. coli. Here we demonstrate that this toxicity is caused by off-target binding of dCas9 to the promoter of essential genes. Silencing of off-target genes can occur with as little as 4nt of identity between the PAM-proximal sequence and the off-target position. This phenomenon only occurs in some promoter sequences but does not appear to be constrained to any specific PAM-proximal sequence. Accordingly, screens performed in various strains of E. coli and related species shows that the nature of toxic guide RNAs changes together with the evolution of the sequence of off-target positions. These results highlight the importance of relying on several guide RNAs targeting the same gene when performing CRISPRi experiments in bacteria in order to avoid any possible confounding results due to off-target binding.
2022-10-25 | GSE216032 | GEO
Project description:To study target sequence specificity, selectivity, and reaction kinetics of Streptococcus pyogenes Cas9 activity, we challenged libraries of random variant targets with purified Cas9::guide RNA complexes in vitro. Cleavage kinetics were nonlinear, with a burst of initial activity followed by slower sustained cleavage. Consistent with other recent analyses of Cas9 sequence specificity, we observe considerable (albeit incomplete) impairment of cleavage for targets mutated in the PAM sequence or in "seed" sequences matching the proximal 8 bp of the guide. A second target region requiring close homology was located at the other end of the guide::target duplex (positions 13-18 relative to the PAM). Strikingly, a subset of variants which broke homology in the intervening region consistently increased the capacity of Cas9 to cleave in extended reactions. Sequences flanking the guide+PAM region had measurable (albeit modest) effects on cleavage. Taken together, these studies provide both a basis for predicting effective cleavage targets and a basis for potential optimization of guide RNAs to yield efficiency beyond that of the simple perfect-match guides.
2014-11-14 | GSE58426 | GEO
Project description:RNA-guided genome editing with the CRISPR-Cas9 system has great potential for basic and clinical research, but the determinants of targeting specificity and the extent of off-target cleavage remain insufficiently understood. Using chromatin immunoprecipitation and high-throughput sequencing (ChIP-seq), we mapped genome-wide binding sites of catalytically inactive Cas9 (dCas9) in HEK293T cells, in combination with 12 different single guide RNAs (sgRNAs). The number of off-target sites bound by dCas9 varied from ~10 to >1,000 depending on the sgRNA. Analysis of off-target binding sites showed the importance of the PAM-proximal region of the sgRNA guiding sequence and that dCas9 binding sites are enriched in open chromatin regions. When targeted with catalytically active Cas9, some off-target binding sites had indels above background levels in a region around the ChIP-seq peak, but generally at lower rates than the on-target sites. Our results elucidate major determinants of Cas9 targeting, and we show that ChIP-seq allows unbiased detection of Cas9 binding sites genome-wide 1.sgRNA1-6 binding sites were identified with ChipSeq by using HA antibody (there are 2 replicates for sgRNA1-3, one sample for sgRNA4-6,one control without sgRNA) 2.PCR products which amplifies " off-target genomic sites" were deep sequenced in the presence of WT Cas9+sgRNA or WT Cas9 alone( unique adaptor was used for each sgRNA and mixed for multiplex run)
2014-05-18 | E-GEOD-55887 | biostudies-arrayexpress
Project description:RNA-guided genome editing with the CRISPR-Cas9 system has great potential for basic and clinical research, but the determinants of targeting specificity and the extent of off-target cleavage remain insufficiently understood. Using chromatin immunoprecipitation and high-throughput sequencing (ChIP-seq), we mapped genome-wide binding sites of catalytically inactive Cas9 (dCas9) in HEK293T cells, in combination with 12 different single guide RNAs (sgRNAs). The number of off-target sites bound by dCas9 varied from ~10 to >1,000 depending on the sgRNA. Analysis of off-target binding sites showed the importance of the PAM-proximal region of the sgRNA guiding sequence and that dCas9 binding sites are enriched in open chromatin regions. When targeted with catalytically active Cas9, some off-target binding sites had indels above background levels in a region around the ChIP-seq peak, but generally at lower rates than the on-target sites. Our results elucidate major determinants of Cas9 targeting, and we show that ChIP-seq allows unbiased detection of Cas9 binding sites genome-wide
2014-05-18 | GSE55887 | GEO
Project description:CRISPR-Cas transcriptional tools have been widely applied for programmable regulation of complex biological networks. In comparison to eukaryotic systems, bacterial CRISPR activation (CRISPRa) has stringent target site requirements for effective gene activation. While genes may not always have an NGG protospacer adjacent motif (PAM) at the appropriate position, PAM-flexible dCas9 variants can expand the range of targetable sites. Here we systematically evaluate a panel of PAM-flexible dCas9 variants for their ability to activate bacterial genes. We observe that dxCas9-NG provides a high dynamic range of gene activation for sites with NGN PAMs while dSpRY permits modest activity across almost any PAM. Similar trends were observed for heterologous and endogenous promoters. For all variants tested, improved PAM-flexibility comes with the tradeoff that CRISPRi-mediated gene repression becomes less effective. Weaker CRISPR interference (CRISPRi) gene repression can be partially rescued by expressing multiple sgRNAs to target many sites in the gene of interest. Our work provides a framework to choose the most effective dCas9 variant for a given set of gene targets, which will further expand the utility of CRISPRa/i gene regulation in bacterial systems.
2022-11-15 | GSE217559 | GEO
Project description:The current work involves the quantitative analysis of total proteome of M. tuberculosis H37Rv depleted with the expression of different clp genes viz., clpP2, clpX and clpC1, respectively, by iTRAQ. Silencing of these genes was performed by CRISPRi approach by co-expression of specific guide sequence and dCas9 under the regulation of ATc-inducible promoter.
2020-03-20 | PXD013156 | JPOST Repository
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
2015-03-04 | E-GEOD-61099 | biostudies-arrayexpress
Project description:Background: The CRISPR/Cas9 toolbox has recently been expanded to include approaches for modulating gene expression. To successfully build on this work, and apply it for answering biological questions, it is important to establish it in a broad range of circumstances. Genome-scale CRISPR interference (CRISPRi) has been used in human cells lines, however the rules for designing effective guide RNAs (gRNAs) in different organisms are not well known. We sought to determine rules that determine gRNA effectiveness at transcriptional repression in Saccharomyces cerevisiae. Results: We created an inducible single plasmid CRISPRi system for gene repression in yeast, and used it to analyze fitness effects of gRNAs under 18 small molecule treatments. Our approach correctly identified previously-described chemical-genetic interactions, as well as a new mechanism of suppressing fluconazole toxicity by repression of the ERG25 gene. Assessment of multiple target loci across treatments allowed us to determine generalizable features associated with gRNA efficacy. Guides that target regions with low nucleosome occupancy and high chromatin accessibility were clearly more effective. We also found the best region to target gRNAs was between the transcription start site (TSS) and 200bp upstream of the TSS. Finally, unlike nuclease-proficient Cas9 in human cells, point mutations were tolerated equally well by truncated (18 nt specificity sequence) and full length (20 nt) gRNAs, however, 18 nt gRNAs were generally less potent than full length gRNAs. Conclusions: Our results establish a powerful functional genomics screening method, provide rules for designing effective gRNAs for gene repression, and show that 18 nt and 20 nt gRNAs exhibit similar tolerance to mismatches in the target sequence. These findings will enable effective library design and genome-wide screening in many genetic backgrounds. An expression construct was created for inducible CRISPRi in yeast. Key features include ORFs expressing dCas9-Mxi1 and the tetracycline repressor (TetR), as well as a tetracycline inducible gRNA locus containing the RPR1 promoter with a TetO site, a NotI site for cloning new gRNA specificity sequences, and the constant part of the gRNA. When yeast containing this plasmid are grown in the absence of anhydrotetracycline (ATc) TetR binds the gRNA promoter and prevents PolIII from binding and transcribing the gRNA. This in turn prevents dCas9-Mxi1 from binding the target site. In the presence of ATc, TetR dissociates and gRNA is expressed, allowing dCas9-Mxi1 to bind its target locus, and repress gene expression. gRNA libraries were cloned into this construct and transformed into yeast to create pools. Experiments were conducted in which yeast pools were grown in inducing (+ATc) and non-inducing conditions (-ATc) in the presence of different drugs. After multiple generations of growth in these conditions, yeast plasmids were minipreped and the gRNA locus was PCRed and sequenced via MiSeq. Counts of each gRNA were compared in different conditions.
2016-01-18 | E-GEOD-71490 | biostudies-arrayexpress
Project description:Using RNA-seq to identify genes regulated by dCas9-KRAB mediated enhancer repression in NCI-H2009 lung adenocarcinoma cells NCI-H2009 cells were first transfected with dCas9-KRAB fusion and subsequently transfected with no guide RNA (Empty), a guide RNA that has no target in the human genome (Dummy), and two separate guide RNAs (e3 #1 and e3 #2) recognizing the enhancer region of our study.
2015-10-26 | E-GEOD-72001 | biostudies-arrayexpress
Project description:CRISPR interference (CRISPRi) genetic screens use programmable repression of gene expression to systematically explore questions in cell biology and genetics. However, wider adoption of CRISPRi screening has been constrained by the large size of single guide RNA (sgRNA) libraries and lack of consensus on the choice of CRISPRi effector proteins. Here, we address these challenges to present next-generation CRISPRi sgRNA libraries and effectors. First, we combine empiric sgRNA selection with a dual sgRNA library design to generate an ultra-compact, highly active CRISPRi sgRNA library. Next, we rigorously compare CRISPRi effectors to show that the recently published Zim3-dCas9 provides an optimal balance between strong on-target knockdown and minimal nonspecific effects on cell growth or the transcriptome. Finally, we engineer a suite of cell lines which stably express Zim3-dCas9 and demonstrate robust on-target knockdown across these cell lines. Our results and publicly available reagents establish best practices for CRISPRi genetic screening.
2022-06-04 | GSE205310 | GEO