Vascular oxidative stress causes neutrophil arrest in brain capillaries, leading to decreased cerebral blood flow and contributing to memory impairment in a mouse model of Alzheimer’s disease
Ontology highlight
ABSTRACT:
ORGANISM(S): Mus musculus
PROVIDER: GSE224394 | GEO | 2023/03/10
REPOSITORIES: GEO
Similar Datasets
Project description:Vascular oxidative stress causes neutrophil arrest in brain capillaries, leading to decreased cerebral blood flow and contributing to memory impairment in a mouse model of Alzheimer’s disease
| PRJNA930761 | ENA
Project description:Presenilin (PS) proteins represent the catalytic subunits of γ-secretase, and play a critical role in the generation of the Amyloid β (Aβ) peptide and the pathogenesis of Alzheimer’s disease (AD). Indeed, mutations in presenilin 1 (PS1) or PS2 are a major cause of early onset familial Alzheimer’s disease (FAD). However, PS proteins also exert multiple functions beyond Aβ generation. In this study, we examine the individual roles of PS1 and PS2 in cellular cholesterol metabolism. Deletion of PS1 or PS2 in mouse models led to cholesterol accumulation in cerebral neurons. Cholesterol accumulation was also observed in lysosomes of embryonic fibroblasts from PS1-KO and PS2-KO mice, and associated with decreased expression of the Niemann-Pick type C1 (NPC1) protein involved in intracellular cholesterol transport at late endosome/lysosome. Mass spectrometry and complementary biochemical methods also revealed abnormal N-glycosylation of NPC1 and several other membrane proteins in PS1-KO and PS2-KO cells. Interestingly, pharmacological inhibition of N-glycosylation resulted in intracellular cholesterol accumulation prominently in lysosomes as well as decrease of NPC1 expression in wild-type MEFs, thereby resembling the changes in PS1-KO and PS2-KO MEFs. In turn, treatment of PS1-KO and PS2-KO MEFs with a chaperone inducer, Arimoclomol, attenuated decrease of NPC1 and rescued the lysosomal cholesterol accumulation. Additionally, the intracellular cholesterol accumulation in PS1-KO and PS2-KO MEFs was prevented by NPC1 overexpression. Collectively, these data indicate that PS/γ-secretase dysfunction results in an impairment of protein N-glycosylation, which eventually causes NPC1 decrease and intracellular cholesterol accumulation. 3'RNASeq of mouse embryonic fibroblasts with PS1- or PS2-deficiency compared with controls. Biological replicates
2024-05-26 | GSE223572 | GEO
Project description:Amyloid plaques and neurofibrillary tangles are present in the brains of individuals with intact memory function. The study of these brains can open new avenues to identify new therapeutic targets. This experriment aimed to identified genes contributing to maintain an intact memory in the presence of AD pathology.
2020-05-07 | GSE147434 | GEO
Project description:1,7-bis(4-hydroxy-3-methoxyphenyl)heptane-3,5-dione (tetrahydrocurcumin, THC) is a major bioactive metabolite of curcumin (the principal active ingredient of Curcuma longa L.), and overcomes the low bioavailability of curcumin, demonstrating the potential anti-inflammatory, antioxidant and neuroprotective properties, etc, some of which were considered to be even superior to curcumin. In the present study, the protective properties of THC in the hippocampus of APP/PS1 mice, and the effects of THC against Aβ-induced toxicity in BV-2 cells were explored. The data in vitro showed that Aβ induced decreased cell viability, and cell cycle arrest and apoptosis in BV-2 cells, which could be ameliorated by THC. In vivo, THC administration was able to rescue learning and memory, and reduce Aβ burden in the hippocampus of APP/PS1 mice. By comprehensive proteomic analysis of the hippocampus of mice, a total of 157 differentially expressed proteins were identified in APP/PS1 mice treated with THC (comparing with APP/PS1 mice), which were enriched in “T cell activation”, “lymphocyte proliferation” and “protein oligomerization”, etc. The results of Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis suggested that the effects of THC on the cell cycle and apoptosis were mostly related to the “Ras signaling pathway” and “JAK−STAT signaling pathway”, etc. Using Western blot and ELISA, the down-regulation of Gab2 and K-Ras, and the up-regulation of caspase-3, TGF-β1 and TNF-ɑ were found in APP/PS1 mice. THC attenuated the abnormal expression of Gab2, K-Ras, caspase-3 and TNF-ɑ, and up-regulated Bag1 and TGF-β1 expression in APP/PS1 mice. In BV-2 cells, Aβ induced the down-regulation of Gab2, K-Ras and TGF-β1, and the overexpression of caspase-3, PARP1, cleaved-PARP1 and TNF-ɑ, which were markedly restored by THC. Moreover, THC up-regulated Bag1 expression in BV-2 cells treated with Aβ. The decreased transcriptional expression levels of Ccnd2 and Cdkn1a was also observed in Aβ-treated BV-2 cells. THC treatment alleviated down-regulation of Ccnd2, but did not affect the abnormal transcriptional expression of Cdkn1a caused by Aβ in BV-2 cells. For the first time, we identified that the action of THC in preventing AD was associated with inhibition of cell cycle arrest and apoptosis of microglia via the Ras/ERK signaling pathway, shedding new light on the role of THC in alleviating the progression of AD.
2021-07-13 | PXD024721 | Pride
Project description:Oxidative stress in adipose tissue and liver has been linked to the development of obesity. NADPH oxidases (NOX) enzymes are a major source of reactive oxygen species (ROS). The current study was designed to determine if NOX2-generated ROS play a role in development of obesity and metabolic syndrome after high fat feeding. Wild type (WT) mice and mice lacking the cytosolic NOX2 activated protein p47phox (P47KO) were fed AIN-93G diets or high fat diets (HFD) containing 45% fat and 0.5% cholesterol for 13 weeks from weaning. Affymetrix array analysis revealed dramatically less expression of mRNA of genes linked to energy metabolism, adipocyte differentiation (PPARM-NM-3, Runx2) and fatty acid uptake (CD36, lipoprotein lipase) in fat pads from female HFD-P47KO mice compared to HFD-WT females. These data suggest that NOX2 is an important regulator of metabolic homeostasis and that NOX2-associated ROS plays an important role in development of diet-induced obesity particularly in the female fat pads from p47phox and wild type fed a high fat or control diet
2012-11-01 | E-GEOD-41932 | biostudies-arrayexpress
Project description:Single-stranded oligos listed below (and the corresponding reverse compliment) were synthesized and annealed: E2F: CTAGATTTCCCGCGGATC (decoy); CTAGACTCTGCTCGGATC (scrambled) KTGGYRSGAA: CTAGATTCCCGCCAAGGATC (decoy); CTAGACAGCTACTCCGGATC (scrambled) TGCGCANK: CTAGACATGCGCAGGATC (decoy); CTAGATCACAGGCGGATC (scrambled) CCAATNNSNNNGCG: CTAGACGCCCTCCGATTGGGGATC (decoy); CTAGATGCACGCTCGGTCCGGATC (scrambled) ACTWSNACTNY: CTAGAGGAGTTGTAGTGGATC (decoy); CTAGAGATAGTGTGTGGGATC (scrambled) HeLa cells were propagated in DMEM (Invitrogen) plus 10% FBS and transfected with 0.5 uM of double-stranded DNA. Total RNA was extracted with TRIzol (Invitrogen) from HeLa cells 2 d after transfection of the indicated decoy oligo or scrambled oligo in duplicate. RNA was amplified using the Ambion Amino Allyl MessageAmp II aRNA kit. For each motif, decoy oligo transfected samples (labeled with Cy5) and the corresponding scrambled oligo transfected samples (labeled with Cy3) were competitively hybridized to HEEBO microarrays as described (http://www.microarray.org/sfgf/heebo.do).
2012-08-23 | GSE39572 | GEO
Project description:Obesity is linked to an increased risk of atrial fibrillation (AF) via increased oxidative stress. While NADPH oxidase II (NOX2), a major source of oxidative stress and reactive oxygen species (ROS) in the heart predisposes to AF, the underlying mechanisms remain unclear. Here, we studied NOX2-mediated ROS production in obesity-mediated AF using Nox2-knock-out (KO) mice and mature human induced pluripotent stem cell-derived atrial cardiomyocytes (hiPSC-aCMs). Diet-induced obesity (DIO) mice and hiPSC-aCMs treated with palmitic acid (PA) were infused with a NOX blocker (apocynin) and a NOX2-specific inhibitor, respectively. We showed that NOX2 inhibition normalized atrial action potential duration and abrogated obesity-mediated ion channel remodeling with reduced AF burden. Unbiased transcriptomics analysis revealed that NOX2 mediates atrial remodeling in obesity-mediated AF in DIO mice, PA-treated hiPSC-aCMs, and human atrial tissue from obese individuals by upregulation of paired-like homeodomain transcription factor 2 (PITX2). Furthermore, hiPSC-aCMs treated with hydrogen peroxide, a NOX2 surrogate, displayed increased PITX2 expression, establishing a mechanistic link between increased NOX2-mediated ROS production and modulation of PITX2. Our findings offer insights into possible mechanisms through which obesity triggers AF and support NOX2 inhibition as a potential novel prophylactic or adjunctive therapy for patients with obesity-mediated AF.
2024-10-09 | GSE271748 | GEO
Project description:Mutations in the type III receptor tyrosine kinase FLT3 are frequent in patients with acute myeloid leukemia (AML) and are associated with a poor prognosis. AML is characterized by the overproduction of reactive oxygen species (ROS), which can induce cysteine oxidation in redox-sensitive signaling proteins. Here, we sought to characterize the specific pathways affected by ROS in AML by assessing oncogenic signaling in primary AML samples. The oxidation or phosphorylation of signaling proteins that mediate growth and proliferation was increased in samples from patient subtypes with FLT3 mutations. These samples also showed increases in the oxidation of proteins in the ROS-producing Rac/NADPH oxidase-2 (NOX2) complex. Inhibition of NOX2 increased the apoptosis of FLT3-mutant AML cells in response to FLT3 inhibitors. NOX2 inhibition also reduced the phosphorylation and cysteine oxidation of FLT3 in patient-derived xenograft mouse models, suggesting that decreased oxidative stress reduces the oncogenic signaling of FLT3. In mice grafted with FLT3 mutant AML cells, treatment with a NOX2 inhibitor reduced the number of circulating cancer cells, and combining FLT3 and NOX2 inhibitors increased survival to a greater extent than either treatment alone. Together, these data raise the possibility that combining NOX2 and FLT3 inhibitors could improve the treatment of FLT3 mutant AML.
2023-05-03 | PXD032104 | Pride
Project description:The leukocyte NADPH oxidase 2 (NOX2) plays a key role in pathogen killing and immunoregulation. Genetic defects in NOX2 result in chronic granulomatous disease (CGD), associated with microbial infections and inflammatory disorders, often involving the lung. Alveolar macrophages (AM) are the predominant immune cell in the airways at steady state, and limiting their activation is important given constant exposure to inhaled materials, yet the importance of NOX2 in this process is not well-understood. Here, we show a previously undescribed role for NOX2 in maintaining lung homeostasis by suppressing AM activation, as studied using CGD mice or mice with selective loss of NOX2 primarily in macrophages. AM lacking NOX2 have increased cytokine responses to TLR2 and TLR4 stimulation ex vivo. Moreover, between 4 and 12 weeks of age, mice with global NOX2 deletion developed an activated CD11bhigh subset of AM with epigenetic and transcriptional profiles reflecting immune activation compared to WT AM. The presence of CD11bhigh AM in CGD mice correlated with increased numbers of alveolar neutrophils and proinflammatory cytokines at steady state as well as increased lung inflammation following insults. Moreover, deletion of NOX2 primarily in macrophages was sufficient for mice to develop an activated CD11bhigh AM subset and accompanying pro-inflammatory sequela. Additionally, we showed that the altered resident macrophage transcriptional profile in the absence of NOX2 is tissue-specific as these changes were not seen in resident peritoneal macrophages. Thus, these data demonstrate that absence of NOX2 in alveolar macrophages leads to their pro-inflammatory remodeling and dysregulates alveolar homeostasis.
2022-04-03 | GSE198768 | GEO
Project description:The leukocyte NADPH oxidase 2 (NOX2) plays a key role in pathogen killing and immunoregulation. Genetic defects in NOX2 result in chronic granulomatous disease (CGD), associated with microbial infections and inflammatory disorders, often involving the lung. Alveolar macrophages (AM) are the predominant immune cell in the airways at steady state, and limiting their activation is important given constant exposure to inhaled materials, yet the importance of NOX2 in this process is not well-understood. Here, we show a previously undescribed role for NOX2 in maintaining lung homeostasis by suppressing AM activation, as studied using CGD mice or mice with selective loss of NOX2 primarily in macrophages. AM lacking NOX2 have increased cytokine responses to TLR2 and TLR4 stimulation ex vivo. Moreover, between 4 and 12 weeks of age, mice with global NOX2 deletion developed an activated CD11bhigh subset of AM with epigenetic and transcriptional profiles reflecting immune activation compared to WT AM. The presence of CD11bhigh AM in CGD mice correlated with increased numbers of alveolar neutrophils and proinflammatory cytokines at steady state as well as increased lung inflammation following insults. Moreover, deletion of NOX2 primarily in macrophages was sufficient for mice to develop an activated CD11bhigh AM subset and accompanying pro-inflammatory sequela. Additionally, we showed that the altered resident macrophage transcriptional profile in the absence of NOX2 is tissue-specific as these changes were not seen in resident peritoneal macrophages. Thus, these data demonstrate that absence of NOX2 in alveolar macrophages leads to their pro-inflammatory remodeling and dysregulates alveolar homeostasis.
2022-04-03 | GSE198771 | GEO