Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Effect of cell-penetrating TLR decoy peptide on LPS-stimulated Bone marrow derived macrophages

ABSTRACT: To investigate the effects of the cell-penetrating TLR decoy peptide, M-CSF generated bone marrow derived macrophages obtained from C57BL6/J mice were pretreated with two different concentrations of the peptide followed by stimulation with LPS for 2 hours. The cells were lyzed and analyzed by RNA Sequencing.

ORGANISM(S): Mus musculus

PROVIDER: GSE224903 | GEO | 2023/02/10

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Similar Datasets

Genome-Wide Localization of a Cell Penetrating Peptide, SVS-1

Project description:Genome-Wide Localization of a Cell Penetrating Peptide, SVS-1

| PRJNA504299 | ENA

Genome-Wide Localization of a Cell Penetrating Peptide, SVS-1

Project description:Chem-seq analysis was conducted to reveal genome-wide localization of a cell penetrating peptide, SVS-1. A549 cells treated with 15 mM of biotin-PEG-GG-SVS-1 for 1 hour were passaged once to remove dead cell debris. After 24 hours incubation from the passage, the treated cells were fixed with formaldehyde to crosslink SVS-1 and chromatin, and total chromatin was subjected to fragmentation by sonication. Chromatin bound by the biotin-PEG-GG-SVS-1 was isolated with avidin-conjugated resin, followed by DNA purification. The input DNAs were also purified and employed as controls for the peak callings. The purified DNAs were subjected to library preparation for deep sequencing by the illumina platform. Sequencing was run by the NextSeq with paired end sequencing (2x76), 100 million clusters /sample.

2018-11-07 | GSE122241 | GEO

Cell cycle motif decoy oligos

Project description:Single-stranded oligos listed below (and the corresponding reverse compliment) were synthesized and annealed: E2F: CTAGATTTCCCGCGGATC (decoy); CTAGACTCTGCTCGGATC (scrambled) KTGGYRSGAA: CTAGATTCCCGCCAAGGATC (decoy); CTAGACAGCTACTCCGGATC (scrambled) TGCGCANK: CTAGACATGCGCAGGATC (decoy); CTAGATCACAGGCGGATC (scrambled) CCAATNNSNNNGCG: CTAGACGCCCTCCGATTGGGGATC (decoy); CTAGATGCACGCTCGGTCCGGATC (scrambled) ACTWSNACTNY: CTAGAGGAGTTGTAGTGGATC (decoy); CTAGAGATAGTGTGTGGGATC (scrambled) HeLa cells were propagated in DMEM (Invitrogen) plus 10% FBS and transfected with 0.5 uM of double-stranded DNA. Total RNA was extracted with TRIzol (Invitrogen) from HeLa cells 2 d after transfection of the indicated decoy oligo or scrambled oligo in duplicate. RNA was amplified using the Ambion Amino Allyl MessageAmp II aRNA kit. For each motif, decoy oligo transfected samples (labeled with Cy5) and the corresponding scrambled oligo transfected samples (labeled with Cy3) were competitively hybridized to HEEBO microarrays as described (http://www.microarray.org/sfgf/heebo.do). genetic_modification_design

2012-08-23 | E-GEOD-39572 | biostudies-arrayexpress

Transcriptomal profiling of early and late response of cells to cell penetrating peptides

Project description:We performed transcriptional profiling of cells treated with different cell penetrating peptides for different timepoints to see the effect of each peptide on cell biology and pathways which are affected by it. In conclusion, CPPs evoke similar response, regardless of the CPP structure or chemistry, mostly afecting genes related to ribosome biogenesis, microtubule dynamics and expression of long non-coding RNAs

2020-07-31 | GSE148689 | GEO

Cell cycle motif decoy oligos

2012-08-23 | GSE39572 | GEO

Regulatory RNA inhibition in human phagocytes using cell-penetrating PNA oligonucleotides

Project description:Here, we determined the ability of peptide nucleic acid (PNA) oligomers, coupled to different cell-penetrating peptides (CPPs), to interfere in regulatory RNA circuits of human blood-derived leukocytes. Using RNA-seq, FACS and confocal microscopy we identified octaarginin as a CPP enabling PNA delivery and sequence-dependent RNA inhibition in blood-derived myeloid cells at nanomolar concentration. At 200 nM, an R8-PNA targeting immune-regulatory microRNA-155 was delivered into nearly 100 % of human macrophages within 24 hours without apparent cytotoxicity, and globally de-repressed microRNA-155 target-mRNAs. This was not observed when coupling the PNA inhibitor to a K3 instead of the R8 peptide. We suggest that CPP choice is a fundamental success-determining factor for therapeutic RNA-inhibition in human myeloid leukocytes.

2021-03-01 | GSE152740 | GEO

Targeted interference of sin3a-tgif1 function by SID decoy treatment inhibits WNT signaling and invasion in triple negative breast cancer cells

Project description:Targeted interference of sin3a-tgif1 function by SID decoy treatment inhibits WNT signaling and invasion in triple negative breast cancer cells. MDA-MB-231 cells were treated with scrambled SID control, 2.5ÂµM SID peptide or untreated for 24h. Sub-confluent cultures of MDA-MB-231 cells were treated with scrambled SID control, 2.5ÂµM SID peptide or untreated for 24h. Experiments were performed as three independent replicates.

2016-07-21 | E-GEOD-84648 | biostudies-arrayexpress

Targeted interference of sin3a-tgif1 function by SID decoy treatment inhibits WNT signaling and invasion in triple negative breast cancer cells

2016-07-21 | GSE84648 | GEO

Efficient engineering of human and mouse primary cells using peptide-assisted genome editing

Project description:Simple and efficient delivery of CRISPR genome editing systems in primary cells remains a major challenge. Here, we describe an engineered Peptide-Assisted Genome Editing (PAGE) CRISPR-Cas system for rapid and robust editing of primary cells. PAGE couples a cell-penetrating Cas protein with a cell-penetrating endosomal escape peptide in a 30-minute incubation that yields up to ~98% editing efficiency in primary human and mouse T cells. PAGE provides a broadly generalizable platform for next generation genome engineering in primary cells. CITATION INFORMATION: Zhang Zhen, Baxter Amy E, Ren Diqiu, Qin Kunhua, Chen Zeyu, Collins Sierra M., Huang Hua, Komar Chad A., Bailer Peter F., Parker Jared B., Blobel Gerd A., Kohli Rahul M., Wherry E. John*, Berger Shelley,*, and Shi Junwei*. Peptide-assisted genome editing permits efficient CRISPR engineering of primary T cells.

2023-03-20 | GSE223805 | GEO

ClariomS Array to determine the effect of a vaspin-derived peptide on gene expression in fully differentiated primary subcutaneous mouse adipocytes

Project description:Screening for potential target proteases of vaspin revealed rapid and specific cleavage within the vaspin N-terminus, releasing short peptides with cell penetrating activity. For microarray analysis to determine the effect of a vaspin-derived peptide on gene expression in adipocytes, fully differentiated primary mouse adipocytes from subcutaneous AT were treated with 100 nM of peptide for 24 h before harvesting, RNA isolation and microarray analysis. Solvent (water) treated cells served as controls.

2021-03-31 | E-MTAB-9592 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data