The effect of KIF11 knockdown on gene expression profile in HepG2 cells
Ontology highlight
ABSTRACT:
ORGANISM(S): Homo sapiens
PROVIDER: GSE238164 | GEO | 2023/07/30
REPOSITORIES: GEO
Similar Datasets
Project description:Over half of prostate cancer harbor overexpression of ETS transcription factors including ERG and ETV1. LNCaP prostate cancer cells have an ETV1 translocation to the MIPOL1 locus on 14q13.3-13q21.1. To determine genes regulated by ETV1, we performed shRNA mediated knockdown of ETV1 using two lentiviral constructs as well as a scrambled shRNA in triplicate. Two pLKO.1 constructs against ETV1 (ETV1sh1: TRCN0000013923, targeting GTGGGAGTAATCTAAACATTT in 3'(B UTR; and ETV1sh2: TRCN0000013925, targeting CGACCCAGTGTATGAACACAA in exon 7) were purchased from Open Biosystems and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. RNA was harvested 3 days after infection and gene expression profiling was performed. Among genes downregulated were many well characterized androgen regulated genes. LNCaP cells logarthmically growing in full serum was infected with three different shRNA lentiviruses. Three days after infection
2013-05-10 | E-GEOD-46329 | biostudies-arrayexpress
Project description:The objective was to evaluate the status of the global hepatic transcriptome in the presence of inhibited calreticulin levels. Results identify a total of 324 genes were altered of which 245 genes were downregulated and 79 genes were upregulated. This suggests that such altered genes might be associated with altered hepatic physiology that are observed during calreticulin deficiency. Total RNA was isolated from HepG2 cells subjected to calreticulin (CRT) siRNA for 24 hours compared to control HepG2 cells subjected to scramble siRNA for 24 hours. This was then hybridized to Illumina HumanHT-12 v4 Expression BeadChip arrays.
2015-07-23 | E-GEOD-57261 | biostudies-arrayexpress
Project description:Hepatocytes are polarized epithelial cells whose function depends upon their ability to distinguish between the apical and basolateral surfaces that are located at intercellular tight junctions. It has been proposed that the signaling cascades that originate at these junctions influence cellular activity by controlling gene expression in the cell nucleus. To assess the validity of this proposal with regard to hepatocytes, we depleted expression of the tight junction protein junctional adhesion molecule-A (JAM-A) in the HepG2 human hepatocellular carcinoma cell line. Reduction of JAM-A resulted in a striking change in cell morphology, with cells forming single-layered sheets instead of the normal multi-layered clusters. In the absence of JAM-A, other tight junction proteins were mislocalized, and canaliculi, which form the apical face of the hepatocyte, were consequently absent. While most changes in gene expression were modest, there was a strong transcriptional induction of the adherens junction protein E-cadherin in cells with reduced levels of JAM-A. This increase in E-cadherin was partially responsible for the observed alterations in cell morphology and mislocalization of tight junction proteins. We therefore propose that we have uncovered a novel mechanism for crosstalk between specific components of tight and adherens junctions that can be utilized to regulate adhesion between hepatic cells and to maintain hepatocyte cell polarity. Experiment Overall Design: HepG2 cells were transduced with lentiviruses and stably selected using puromycin. Comparison of four controls and five JAM-A knockdown samples.
2008-06-14 | E-GEOD-6080 | biostudies-arrayexpress
Project description:Poly(ADP-ribose) polymerase-2 (PARP-2) is acknowledged as a DNA repair enzyme; however, recently metabolic properties had been attributed to it. Hereby, we examined the metabolic consequences of PARP-2 ablation in liver. Microarray analysis of PARP-2 knockdown HepG2 cells revealed the dysregulation of lipid and cholesterol metabolism genes. Induction of cholesterol biosynthesis genes stemmed from the enhanced expression of sterol-regulatory element binding protein (SREBP)-1. We revealed that PARP-2 is a suppressor of the SREBP-1 promoter, therefore ablation of PARP-2 induces SREBP-1 expression and consequently cholesterol synthesis. PARP-2-/- mice had higher SREBP-1 expression that was translated into enhanced hepatic and serum cholesterol levels. PARP-2 silencing was performed employing shPARP-2 (small hairpin) and scPARP-2 (scrambled) shRNA by lentiviral delivery (Sigma) using 40 MOI lentiviruses coding shRNA sequence against PARP-2.
2013-12-31 | E-GEOD-43981 | biostudies-arrayexpress
Project description:High-throughput sequencing was employed to analyze the genes whose expression are altered when lncRNA LAST is downregulated by shRNA in HCT116 cells. The Gencode Gene ID of lncRNA LAST is ENSG00000254682.1.
2017-11-16 | GSE106917 | GEO
Project description:Acute myeloid leukemia (AML) and acute T-lymphoblastic leukemia (T-ALL) maintain the undifferentiated phenotype and proliferative capacity of their respective cells of origin, hematopoietic stem/progenitor cells and immature thymocytes. The mechanisms that maintain these progenitor-like characteristics are poorly understood. We report that the transcription factor Zfx is required for the development and propagation of experimental AML caused by MLL-AF9 fusion, and of T-ALL caused by Notch1 activation. In both leukemia types, Zfx activated progenitor-associated gene expression programs and prevented differentiation. Key Zfx target genes included mitochondrial enzymes Ptpmt1 and Idh2, whose overexpression partially rescued the propagation of Zfx-deficient AML. These studies identify a common mechanism that controls the cell-of-origin characteristics of acute leukemias derived from disparate lineages and transformation mechanisms. NOMO-1 cells were infected with control and ZFX shRNA lentiviruses at an MOI of 1. RNA was collected for microarrays 48 hours after selection.
2015-01-01 | E-GEOD-43021 | biostudies-arrayexpress
Project description:To investigate the effect of STAT3 knockdown on transcription, we constructed control and STAT3 knockdown HepG2 cell lines by shRNA. We then performed gene expression profiling using data obtained from RNA-seq.
2022-12-07 | GSE220283 | GEO
Project description:We want to determine the protein networks that are associated with KIF11 in the presenceor absence of Rab11 in Caco2 cells. We performed immunoprecipitation against KIF11 using an anti-KIF11 antibody in control and Rab11 knockdown Caco2 cells In addition, we included samples of no antibody control to assess background binding.
2023-06-05 | PXD042335 | Pride
Project description:Illumina array was employed to analyze the genes whose expression are altered when ARID1A gene is downregulated by shRNA in normal ovarian surface epithelial cells OSE4 and IOSE80pc. This leads to discovery of p53-regulated genes such as p21 and SMAD3. ARID1A knockdown in OSE4 and IOSE80pc
2012-05-01 | E-GEOD-37684 | biostudies-arrayexpress
Project description:Illumina array was employed to analyze the genes whose expression are altered when ARID1A gene is downregulated by shRNA in normal ovarian surface epithelial cells OSE4 and IOSE80pc. This leads to discovery of p53-regulated genes such as p21 and SMAD3.
2012-05-02 | GSE37684 | GEO