Nuclear Pirin promotes HCC by acting as a key inflammation-facilitating factor
Ontology highlight
ABSTRACT:
ORGANISM(S): Mus
PROVIDER: GSE240133 | GEO | 2025/07/12
REPOSITORIES: GEO
Similar Datasets
Project description:Nuclear Pirin promotes HCC by acting as a key inflammation-facilitating factor
| PRJNA1002341 | ENA
Project description:Pirin (PIR) is a putative transcriptional regulator whose expression is silenced in cells bearing the AML1/ETO and PML/RAR leukemogenic fusion proteins and is significantly repressed in a large proportion of acute myeloid leukemias. PIR expression increases during in vitro myeloid differentiation of primary hematopoietic precursor cells, and ablation of PIR in the U937 myelomonocytic cell line or in murine primary hematopoietic precursor cells results in impairment of terminal myeloid differentiation. Keywords: Transcriptional regulation, knock-down using shRNA We analyzed gene expression profiles of U937 cells after knock-down of PIR using the shPIR#7 oligonucleotides cloned in the pSICO-R lentiviral vector. No residual PIR protein is detectable in U937-shPIR#7 cells by Western blotting. U937 cells containing the empty cloning vector (U937-pSICO) were used as control. shPIR#7 oligonucleotide sequences: Human PIR#7-for: TGAAGCCACTTTGTCTTAATTTCAAGAGAATTAAGACAAAGTGGCTTCTTTTTTC Human PIR#7-rev: TCGAGAAAAAAGAAGCCACTTTGTCTTAATTCTCTTGAAATTAAGACAAAGTGGCTTCA For each sample, an RNA pool was obtained by mixing equal quantities of total RNA from each of three independent RNA extractions. Each biotin-labeled target was hybridized to two GeneChip HG-U133 Plus v.2 arrays.
2009-12-10 | E-GEOD-16798 | biostudies-arrayexpress
Project description:Pirin (PIR) is a putative transcriptional regulator whose expression is silenced in cells bearing the AML1/ETO and PML/RAR leukemogenic fusion proteins and is significantly repressed in a large proportion of acute myeloid leukemias. PIR expression increases during in vitro myeloid differentiation of primary hematopoietic precursor cells, and ablation of PIR in the U937 myelomonocytic cell line or in murine primary hematopoietic precursor cells results in impairment of terminal myeloid differentiation. Keywords: Transcriptional regulation, knock-down using shRNA
2009-12-10 | GSE16798 | GEO
Project description:Pirin (PIR) is a putative transcriptional regulator abundantly expressed in melanocytes and in a subset of primary and metastatic melanomas. Ablation of PIR in the melanoma cell lines results in induction of a senescence-like phenotype. Keywords: Transcriptional regulation, knock-down using siRNA We analyzed gene expression profiles of WM-266.4 metastatic melanoma cells after knock-down of PIR, which was achieved using a pool of four PIR-siRNA duplexes (siPIR). A pool of four non-targeting siRNA duplexes was used as control of off-target transcriptional effects (siCTR). Cells that underwent transfection with no oligonucleotides (oligofectamine only) were also included to measure all non-specific effects (NO cells). For each sample, an RNA pool was obtained by mixing equal quantities of total RNA from each of three independent RNA extractions. Each biotin-labeled target was hybridized to two GeneChip HG-U133 Plus v.2 arrays.
2010-08-04 | E-GEOD-17551 | biostudies-arrayexpress
Project description:Pirin (PIR) is a putative transcriptional regulator abundantly expressed in melanocytes and in a subset of primary and metastatic melanomas. Ablation of PIR in the melanoma cell lines results in induction of a senescence-like phenotype. Keywords: Transcriptional regulation, knock-down using siRNA
2010-08-04 | GSE17551 | GEO
Project description:Hepatocellular carcinoma (HCC) is an inflammation-associated cancer arising from viral and non-viral etiologies. Expansion of suppressive myeloid cells is a hallmark of chronic inflammation and cancer, but their heterogeneity in HCC is not fully resolved and might underlie immunotherapy resistance in the steatohepatitis setting. Here, we present a high resolution atlas of hepatic innate immune cells from patients with HCC that unravels a steatohepatitis contexture characterized by influx of inflammatory and immunosuppressive myeloid cells. A discrete myeloid cell population identified by selective expression of TREM1 and CD163 expands in steatohepatitis-HCC. We refer to this population as TREM1+ regulatory myeloid cells (Mreg), as it potently suppresses T cell effector functions, highly expresses TGFB1 and IL13RA1 and localizes to HCC fibrotic lesions.
2024-02-04 | GSE245908 | GEO
Project description:Hepatocellular carcinoma (HCC) is an inflammation-associated cancer arising from viral and non-viral etiologies. Expansion of suppressive myeloid cells is a hallmark of chronic inflammation and cancer, but their heterogeneity in HCC is not fully resolved and might underlie immunotherapy resistance in the steatohepatitis setting. Here, we present a high resolution atlas of hepatic innate immune cells from patients with HCC that unravels a steatohepatitis contexture characterized by influx of inflammatory and immunosuppressive myeloid cells. A discrete myeloid cell population identified by selective expression of TREM1 and CD163 expands in steatohepatitis-HCC. We refer to this population as TREM1+ regulatory myeloid cells (Mreg), as it potently suppresses T cell effector functions, highly expresses TGFB1 and IL13RA1 and localizes to HCC fibrotic lesions.
2024-02-04 | GSE245906 | GEO
Project description:Hepatocellular carcinoma (HCC) is an inflammation-associated cancer arising from viral and non-viral etiologies. Expansion of suppressive myeloid cells is a hallmark of chronic inflammation and cancer, but their heterogeneity in HCC is not fully resolved and might underlie immunotherapy resistance in the steatohepatitis setting. Here, we present a high resolution atlas of hepatic innate immune cells from patients with HCC that unravels a steatohepatitis contexture characterized by influx of inflammatory and immunosuppressive myeloid cells. A discrete myeloid cell population identified by selective expression of TREM1 and CD163 expands in steatohepatitis-HCC. We refer to this population as TREM1+ regulatory myeloid cells (Mreg), as it potently suppresses T cell effector functions, highly expresses TGFB1 and IL13RA1 and localizes to HCC fibrotic lesions.
2024-02-04 | GSE245905 | GEO
Project description:Hepatocellular carcinoma (HCC) has dismal treatment responses to systemic therapies and is caused by both, viral and non-viral etiologies, including non-alcoholic steatohepatitis (NASH) 1–5. NASH - triggered by high caloric intake and sedentary lifestyle - has become an important driver for HCC development. Immunotherapy has been recently approved for HCC but stratification of responders versus non-responders has remained an unmet need 5–8. Here, we found a progressive accumulation of non-classical activated CD8+PD-1+ T-cells in livers of NASH-affected patients and mice. PD-L1/PD-1-targeted immunotherapy of NASH-induced HCC administered either at cancer-initiation or after cancer-establishment lacked beneficial effects in mice. On the contrary, PD-1-targeted immunotherapy drove hepatic necro-inflammation and increased liver cancer incidence, tumor number, and nodule size. Anti-CD8 or anti-CD8/anti-NK1.1 treatment suppressed liver cancer development, implicating CD8+ T-cells as liver cancer drivers in the context of NASH. In line, PD-1-/- mice challenged with a NASH-inducing diet displayed early-onset of liver cancer. Mechanistically, PD-1-targeted immunotherapy triggered necro-inflammation and a pro-tumorigenic environment in the context of NASH, increasing the abundance of hepatic TOX+CXCR6+ expressing CD8+PD-1+ TNF+ T-cells. Anti-CD8/anti-PD-1 or anti-TNF/anti-PD-1, but not anti-CD4/anti-PD-1 treatment reverted anti-PD1 treatment-related increase of liver inflammation, NASH severity and tumorigenesis. Gene expression profile and increased abundance of murine hepatic CD8+PD-1+ T-cells were corroborated in human CD8+PD-1+ T cells derived from NASH patients. In a meta-analysis of clinical trials testing PD-1-targeting immune checkpoint inhibitors alone (i.e. pembrolizumab) or in combination in 1656 patients with advanced HCC, immunotherapy was not favorable over to control treatment in non-viral- when compared to viral-related HCC. Similarly, in two clinical cohorts tested, patients with NASH-driven HCC had a significantly worse overall survival with PD-1-targeted immunotherapy than HCC patients with other etiologies. Our data identify non-viral etiologies, particularly NASH, as potentially non-responsive in the context of HCC immunotherapy, providing a strong rational basis for patient stratification.
2020-10-24 | GSE159977 | GEO
Project description:Insufficient microwave ablation (IMWA) is linked to aggressive hepatocellular carcinoma (HCC) progression. An increase in lactate level after sublethal heat stress (HS) has been confirmed in HCC. However, the role of lactate-related histone lactylation in the progression of HCC underwent sublethal HS remains unclear. Here, we found that the metastatic potential of HCC is enhanced in a lactate-dependent manner after IMWA. Meanwhile, sublethal HS triggers an upregulation of H3K18la modification, as validated in a cell-derived xenograft mouse model and human HCC samples. By employing an integration analysis of proteomic and transcriptomic profiling, we revealed that HCC cells exhibit an upregulation of intracellular iron ion homeostasis and develop resistance to platinum-based drugs after exposure to sublethal HS. We subsequently integrated proteomic and transcriptomic data with H3K18la-specific chromatin immunoprecipitation (ChIP) sequencing to identify candidate genes involved in sublethal heat treatment-induced HCC cell metastasis. Mechanically, the upregulation of H3K18la modification enhances the transcriptional activity of NFS1, a key player in iron-sulfur clusters biosynthesis, thereby reducing the susceptibility of HCC to ferroptosis post IMWA. Knocking down NFS1 diminished the metastatic potential of sublethal heat-treated HCC cell. Additionally, the deficiency of NFS1 exhibited a synergistic effect with oxaliplatin, leading to a significant inhibition of the metastatic capability of HCC cells both in vitro and in vivo, regardless of HS treatment. In conclusion, our study reveals the oncogenic role of Histone lactylation in HCC after IMVA, we also bridge histone lactylation with ferroptosis, which provides novel therapeutic targets for HCC following microwave ablation, particularly when combined with oxaliplatin-based chemotherapy.
2025-03-12 | GSE279569 | GEO