Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Examination and comparison of the RNA extraction methods using mouse serum

ABSTRACT: Serum miRNAs are considered useful as non-invasive biomarkers for various diseases, but the optimal method for extracting RNA from serum is currently unknown. In this study, several RNA extraction kits were used to determine which kit is the optimal method. RNA was extracted from the serum of 8-week-old C57BL/6NJcl male mice according to the protocol of each RNA extraction kit. The yield of extracted RNA samples was calculated and electrophoretic patterns were evaluated by Agilent bioanalyzer. Expression patterns of the extracted RNA samples were confirmed by Agilent mouse miRNA microarray. The results showed significant differences in RNA yields in the miRNeasy serum/plasma advanced kit, and mirVana™ PARIS™ RNA and Native Protein Purification Kit compared to almost all other samples. Furthermore, two peaks were identified in the miRNeasy serum/plasma advanced kit using small RNA kit of Agilent bioanalyzer, one at 20-40 nucleotides (nt) and the other around 40-100 nt whereas the other reagents had a single peak. In addition, a high correlation was observed between the two RNA extraction kits in microarray. These results suggest that the above two kits are suitable for miRNA extraction from mouse serum.

ORGANISM(S): Mus musculus

PROVIDER: GSE246437 | GEO | 2024/01/01

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Similar Datasets

Real-time quantitative PCR analysis of serum miRNA in response to ionizing radiation in mice

Project description:Kunming mice were total body irradiated by 0.5Gy and 2Gy carbon ions radaition. After 24 hours, blood was collected and serum was isolated. Total RNA of serum sample was extracted by miRNeasy Serum/Plasma Kit (Qiagen, Germany). Then, miRCURY LNA™ Universal RT microRNA PCR, Ready-to-Use Mouse&Rat Panel I V3 (Exiqon, Denmark) containing 384 assays was performed to profile miRNAs differential expression in these serum sample.

2016-09-10 | GSE86625 | GEO

Extraction of Entamoeba histolytica membrane proteins using three extraction methods

Project description:Entamoeba histolytica membrane proteins are important players in the parasite’s pathogenicity. However, most of the proteins have not been identified. This study reports the membrane proteins extracted using three extractions methods: two commercial kits (ProteoExtract® from Calbiochem and ProteoPrep® from Sigma), and a conventional laboratory method. The resulting membrane fractions (MF) and cytosolic fractions (CF)were analysed using LC-ESI-MS/MS. The proteins identified in at least two out of three biological replicates revealed a total of 490, 492, and 587 MF proteins extracted using the ProteoExtract® kit, ProteoPrep® kit and conventional method, respectively. Meanwhile, 487, 611 and 343 proteins were identified in the CF extracted using the ProteoExtract® kit, ProteoPrep® kit and conventional method, respectively. Analysis of the identified MF and CF proteins extracted by the respective extraction kits suggests that the ProteoPrep® extraction kit was the most selective in separating MF and CF among the three extraction methods.

2018-10-16 | PXD010171 | Pride

Liver treatments Con, Veh, Dex

Project description:Mouse liver RNA was extracted using Trizol (Invitrogen) and Qiagen RNeasy kits. RNA was checked with an Agilent Bioanalyzer for evidence of sub-genomic DNA and degradation. Targets were produced using standard Affymetrix protocols. Each sample represents data from a single mouse liver. Keywords: other

2004-06-30 | GSE564 | GEO

A comparison of RNA extraction and sequencing protocols for detection of small RNAs in plasma

Project description:We compared 3 small RNA library prep kits (CleanTag, NEXTflex, QIAseq) and two RNA extraction methods (miRNeasy and MagnaZol) on plasma. We report that library preparation has a significant effect upon the miRNA profile detected, with QIAseq libraries exhibiting the least sequencing bias of the three library kits. RNA extraction methods also contribute, to a lesser extent, to the miRNA profile detected, with MagnaZol RNA extraction increasing the percentage of reads mapping to miRNAs and the number of individual miRNAs detected.

2019-05-21 | GSE118125 | GEO

Transcriptomic profiling and analyses of murine prostate orthografts

Project description:RNA was extracted from the frozen prostate tumours or tissues of P1 prostate tumours (n=3), CP1 prostate tumours (n=3) and CP2 prostate tumours (n=4). RNA quality of RNA extracted was evaluated by RNA integrity number (RIN>7.3), calculated using an Agilent 2100 Bioanalyzer (Agilent Technologies) with the Agilent RNA 6000 Nano Kit.

2022-08-20 | GSE136084 | GEO

Intrahepatic MAIT cell gene expression revealed by RNA-seq

Project description:RNA-seq was carried out as described by Simone Picelli et al. with minor modifications (Genome Res 2014;24:2033-40). Briefly, RNA was extracted from 5000 cells using a miRNeasy Micro Kits (Qiagen, German). RNA quality was assessed with an Agilent RNA 6000 Pico Kit (Agilent Technologies, cat#5067-1513, USA) on an Agilent 2100 Bioanalyzer. Each library was prepared from 2ng of total RNA. After reverse transcription, cDNA was amplified for 8 cycles followed by Agencourt AMPure XP purification, the quality of cDNA library was checked on an Agilent High Sensitivity DNA Kit (Agilent Technologies, cat#5067-4626). The cDNA was sheared to a 200-500 bp size range using the Covaris AFA system. The final library was carried out by using the NEB Next ULTRA II DNA Prep Kit, and their quality and size were checked using the Agilent High Sensitivity DNA Kit. The libraries were sequenced using a Hiseq 4000 system (Illumina, USA). At least million reads were obtained for each sample. For all RNA-seq reads, we cut the 5’ adaptor (AAGCAGTGGTATCAACGCAGAGTACAT GGG) using cutadapt (version 1.10) with the parameter –e 0.17, and then aligned to the hg19 genome using OSA (version 2.10.8). The aligned data were merged and count by Samtools (version 0.1.19+), and differentially expressed genes were found based on the edgeR with default parameters (Bioinformatics 2010;26:139-40). A gene was differentially expressed if (1) p < 0.05 (2) |log2(fold change)| > 1. For hierarchical clustering, the RPKM values of differentially expressed genes were log2-transformed and standardized. 1- Pearson correlation was then used as the distance for clustering. Differentially expressed genes were selected for GO analysis using R package clusterProfiler (Omics 2012;16:284-7).

2018-12-01 | GSE117627 | GEO

Bayogenin 3-O-Cellobioside is a novel anti-blast metabolite produced in rice in response to Pyricularia oryzae infection

Project description:Susceptible (CO39 and NPB) and resistant (Pi_gm) rice cultivars were spray inoculated with P. oryzae spore and incubated for 12-hours. Total RNA was extracted from the inoculated rice seedlings (T_Co39, T_NPB, and T_gm) along with their non-inoculated control group C_Co39, C_NPB, and C_gm. The extraction of total RNA from inoculated and non-inoculated control samples was carried-out with RNAprep pure Plant Kit (Tiangen, Beijing) by following processes recommended by the manufacturer. To observe the level of RNA degradation and contamination, the extracted RNA was run on 1% agarose gels. RNA integrity was assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). RNA concentration was measured with RNA Assay Kit in Qubit 2.0 Fluorometer (Life Technologies, CA, USA). The cDNA library was sequenced on the Illumina sequencing platform (Illumina HiSeq™ 2000) with 150 bp pair-end reads length and 300 bp insert size by Gene Denovo Co. (Guangzhou, China). Novogene in-house Perl script was used to select clean reads by removing adaptor sequences, low quality sequences (reads with more than 50% of bases quality lower than 20) and reads with more than 5% N bases.

2019-02-23 | GSE126961 | GEO

Circulating MicroRNAs and Treatment Response in Childhood Asthma

Project description:Total RNA was isolated from serum samples by the Qiagen miRNeasy Serum/Plasma extraction kit and QIAcube automation. All samples were quantified using the Nanodrop spectrophotometer prior to plating. Small RNA-seq libraries were prepared using the Norgen Biotek Small RNA Library Prep Kit and then sequenced on the Illumina NextSeq 500 platform at 51bp single end reads. ExceRpt was employed to assess the read quality and annotate miRNAs. The read count was log transformed and normalized by quantile normalization.

2020-07-08 | GSE134897 | GEO

Nassar2022 - Microbome nucleic acid extraction kit NER model

Project description:Microbiome nucleic acid extraction kit model is a Named Entity Recognition (NER) model that identifies and annotates the name of the kits used in extracting microbiome nucleic acids in texts. This is the final model version used to annotate metagenomics publications in Europe PMC and enrich metagenomics studies in MGnify with kits metadata from literature. For more information, please refer to the following blogs: http://blog.europepmc.org/2020/11/europe-pmc-publications-metagenomics-annotations.html https://www.ebi.ac.uk/about/news/service-news/enriched-metadata-fields-mgnify-based-text-mining-associated-publications

2022-02-21 | MODEL2202170007 | BioModels

Exploring modulation in Staphylococcus aureus biofilm formation and virulence during platelet storage and its impact on platelet functionality

Project description:Staphylococcus aureus CBS2016-05 and PS/BAC/317/16/W were spiked (4E+06 CFU/ml) into platelet concentrates (PCs) and Trypticase soy broth (TSB) and allowed to grow until early stationary phase (6 days) at 22-24°C. Subsequently, the cells were pelleted at 4°C and subjected to RNA extraction using the miRNeasy Mini Kit, following the manufacturer's instructions. To eliminate genomic DNA, the RNA samples from three independent biological replicates were treated with TURBO™ DNase AmbionTM (Thermo Fisher Scientific).

2023-08-28 | GSE241582 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data