Hypermethylation of miR-34b is associated with CREB overexpression and Myeloid Cell Transformation
Ontology highlight
ABSTRACT:
ORGANISM(S): Homo sapiens
PROVIDER: GSE25300 | GEO | 2012/11/30
SECONDARY ACCESSION(S): PRJNA134783
REPOSITORIES: GEO
Similar Datasets
Project description:Increased CREB levels and upregulation of its target genes expression resulted in increased myelopoiesis and colony formation. Class comparison between MDS patients at diagnosis and evolution in AML
2012-11-30 | E-GEOD-25300 | biostudies-arrayexpress
Project description:MicroRNA-34b down-regulation in acute myeloid leukemia was previously shown to induce CREB overexpression, thereby causing leukemia proliferation in vitro and in vivo. The role of microRNA-34b and CREB in patients with myeloid malignancies has never been evaluated. We examined microRNA-34b expression and the methylation status of its promoter in cells from patients diagnosed with myeloid malignancies. We used gene expression profiling to identify signatures of myeloid transformation. We established that microRNA-34b has suppressor ability and that CREB has oncogenic potential in primary bone marrow cell cultures and in vivo. MicroRNA-34b was found to be up-regulated in pediatric patients with juvenile myelomonocytic leukemia (n=17) and myelodysplastic syndromes (n=28), but was down-regulated in acute myeloid leukemia patients at diagnosis (n=112). Our results showed that hypermethylation of the microRNA-34b promoter occurred in 66% of cases of acute myeloid leukemia explaining the low microRNA-34b levels and CREB overexpression, whereas preleukemic myelodysplastic syndromes and juvenile myelomonocytic leukemia were not associated with hypermethylation or CREB overexpression. In paired samples taken from the same patients when they had myelodysplastic syndrome and again during the subsequent acute myeloid leukemia, we confirmed microRNA-34b promoter hypermethylation at leukemia onset, with 103 CREB target genes differentially expressed between the two disease stages. This subset of CREB targets was confirmed to associate with high-risk myelodysplastic syndromes in a separate cohort of patients (n=20). Seventy-eight of these 103 CREB targets were also differentially expressed between healthy samples (n=11) and de novo acute myeloid leukemia (n=72). Further, low microRNA-34b and high CREB expression levels induced aberrant myelopoiesis through CREB-dependent pathways in vitro and in vivo. In conclusion, we suggest that microRNA-34b controls CREB expression and contributes to myeloid transformation from both healthy bone marrow and myelodysplastic syndromes. We identified a subset of CREB target genes that represents a novel transcriptional network that may control myeloid transformation.
| S-EPMC3659992 | biostudies-literature
Project description:To examine the role of CREB overexpression in hematopoiesis, we created a model of leukemia in zebrafish by overexpressing the human CREB in the myeloid hematopoietic lineage. Whole transcriptome analysis of kidney-marrow revealed 171 genes differently expressed between CREB- and control-zebrafish (five per group). Interestingly, the integration of this signature with human deposited data revealed that this tumor resembled a human AML at transcriptome level.
2016-12-06 | GSE71270 | GEO
Project description:Background. The cAMP Response Element Binding Protein, CREB, is a transcription factor that regulates cell proliferation, differentiation, and survival in several model systems, including neuronal and hematopoietic cells. We demonstrated that CREB is overexpressed in acute myeloid and leukemia cells compared to normal hematopoietic stem cells. CREB knockdown inhibits leukemic cell proliferation in vitro and in vivo, but does not affect long-term hematopoietic reconstitution. Therefore, we propose CREB to be a potential target for therapy. To understand downstream pathways regulating CREB, we performed expression profiling with RNA from the K562 myeloid leukemia cell line. Results. By combining our expression data from CREB knockdown cells with prior ChIP data on CREB binding we were able to identify a list of putative CREB regulated genes. We performed extensive analyses on the top genes in this list as high confidence CREB targets. We found that this list is enriched for genes involved in cancer, and unexpectedly, highly enriched for histone genes. Furthermore, histone genes regulated by CREB were more likely to be specifically expressed in hematopoietic lineages. The transcription factor Elk-1 was upregulated in response to CREB deletion. Conclusions. We have identified a high confidence list of CREB targets in K562 cells. These genes allow us to begin to understand the mechanisms by which CREB contributes to acute leukemia. In particular, we speculate that the regulation of histone genes may play an important role in this process, by possibly altering the regulation of DNA replication during the cell cycle.
2008-08-30 | GSE12056 | GEO
Project description:The cAMP response element-binding protein (CREB) is a nuclear transcription factor that is critical for normal and neoplastic hematopoiesis. Previous studies have demonstrated that CREB is a proto-oncogene whose overexpression promotes cellular proliferation in hematopoietic cells. Transgenic mice that overexpress CREB in myeloid cells develop a myeloproliferative disease with splenomegaly and aberrant myelopoiesis. However, CREB overexpressing mice do not spontaneously develop acute myeloid leukemia. In this study, we used retroviral insertional mutagenesis to identify genes that accelerate leukemia in CREB transgenic mice. Our mutagenesis screen identified several integration sites, including oncogenes Gfi1, Myb, and Ras. The Sox4 transcription factor was identified by our screen as a gene that cooperates with CREB in myeloid leukemogenesis. We show that the transduction of CREB transgenic mouse bone marrow cells with a Sox4 retrovirus increases survival and self-renewal of cells in vitro. Furthermore, leukemic blasts from the majority of acute myeloid leukemia patients have higher CREB, phosphorylated CREB, and Sox 4 protein expression. Sox4 transduction of mouse bone marrow cells results in increased expression of CREB target genes. We also demonstrate that CREB is a direct target of Sox4 by chromatin immunoprecipitation assays. These results indicate that Sox4 and CREB cooperate and contribute to increased proliferation of hematopoietic progenitor cells.
| S-EPMC3390953 | biostudies-literature
Project description:Transcription factor CREB regulates lens Epithelial-Mesenchymal Transition（EMT）in both S133 phosphorylation dependent and independent manners. We found that S133A-CREB can activate lens EMT, while R314A-CREB attenuated it. To understand the mechanism by which S133A-CREB and R314A-CREB modulates EMT gene expression. ChIP assay using CREB antibody in the in the mouse lens epithelial cells alpha-TN4 overexpressing Vector, WT-CREB, S133A-CREB, R314A-CREB and S133A/R314A-CREB, and ChIP-seq was conducted on the ChIP DNA. We found that WT-CREB, S133A-CREB as well as R314A-CREB binds to the promoter regions of mesenchymal genes, and S133A-CREB retained canonical CREB binding motif, while R314A-CREB exhibited shifted binding motif preference to ATF1.
2025-02-05 | GSE276462 | GEO
Project description:Background. The cAMP Response Element Binding Protein, CREB, is a transcription factor that regulates cell proliferation, differentiation, and survival in several model systems, including neuronal and hematopoietic cells. We demonstrated that CREB is overexpressed in acute myeloid and leukemia cells compared to normal hematopoietic stem cells. CREB knockdown inhibits leukemic cell proliferation in vitro and in vivo, but does not affect long-term hematopoietic reconstitution. Therefore, we propose CREB to be a potential target for therapy. To understand downstream pathways regulating CREB, we performed expression profiling with RNA from the K562 myeloid leukemia cell line. Results. By combining our expression data from CREB knockdown cells with prior ChIP data on CREB binding we were able to identify a list of putative CREB regulated genes. We performed extensive analyses on the top genes in this list as high confidence CREB targets. We found that this list is enriched for genes involved in cancer, and unexpectedly, highly enriched for histone genes. Furthermore, histone genes regulated by CREB were more likely to be specifically expressed in hematopoietic lineages. The transcription factor Elk-1 was upregulated in response to CREB deletion. Conclusions. We have identified a high confidence list of CREB targets in K562 cells. These genes allow us to begin to understand the mechanisms by which CREB contributes to acute leukemia. In particular, we speculate that the regulation of histone genes may play an important role in this process, by possibly altering the regulation of DNA replication during the cell cycle. Experiment Overall Design: Cell lines. The following human leukemia cell lines were transduced with shRNAs: K562 (Iscoves + 10% FCS) and TF-1 (RPMI + 10%FCS + rhGM-CSF. Cells were cultured at 37oC, 5% CO2 and split every 3 to 4 days. Primary AML bone marrow samples were processed as previously described [12]. All human samples were obtained with approval from the Institutional Review Board and consents were signed, according to the Helsinki protocol. Experiment Overall Design: shRNA sequence design and constructs. The CREB specific shRNA sequences were selected and validated based on accepted parameters established by Tuschl et al. [25-27]; CREB shRNA-1, CREB shRNA-2, CREB shRNA-3. Controls included empty vector, luciferase shRNA, and scrambled shRNA. shRNA sequences are: CREB shRNA-1(5âGCAAATGACAGTTCAAGCCC3â), shRNA-2 (5âGTACAGCTGGCTAACAATGG3â), shRNA-3 (5âGAGAGAGGTCCGTCTAATG3â), Luciferase shRNA (5âGCCATTCTATCCTCTAGAGGA3â), Scramble shRNA (5âGGACGAACCTGCTGAGATAT3â). Short-hairpin sequences were synthesized as oligonucleotides and annealed according to standard protocol. Annealed shRNAs were then subcloned into pSICO-R shRNA vectors from the Jacks laboratory at MIT [28]. The second generation SIN vector HIV-CSCG was used to produce human shRNA vectors [29]. Experiment Overall Design: Microarray analysis. Total RNA (10 μg) was extracted from K562 cells transduced with vector alone or CREB shRNA was submitted to the UCLA DNA Microarray Facility. RNA samples were labeled and hybridized by standard protocol to Affymetrix GeneChip Human Genome U133+ Array Set HG-U133A array. Gene expression values were calculated using the MAS5 software. The expression values are quantile normalized across all arrays. We obtained the expression profiles for a control set and CREB downregulated K562 cells. These are first quantile normalized, and then a t-test is performed between the two groups to identify significantly differentially regulated genes. The analysis was performed using Matlab (Mathworks, Inc.). A normal quantile plot of T is shown in figure qqplot.tiff. Data points with t-scores < 1/(2N) display with red circles, were N is the total number of genes. We therefore see that there are a significant number of differentially expressed genes, which are either direct or indirect targets of CREB.
2008-10-25 | E-GEOD-12056 | biostudies-arrayexpress
Project description:Analyzing CREB binding motif and sites in the mouse lens epithelial cells alpha-TN4 overexpressing Vector, WT-CREB, S133A-CREB, R314A-CREB and S133A/R314A –CREB.
| PRJNA1157419 | ENA
Project description:CREB regulates lens EMT in both S133 phosphorylation dependent and independent manners. We found that S133A-CREB activated, while R314A-CREB attenuated lens mesenchymal marker gene Fn1 and Snail2. To better understand the mechanism by which S133A and R314A mutations modulate EMT gene expression. RNA-seq on the alpha-TN4 overexpressing Vector, WT-CREB, KCREB, R314A-CREB, S133A-CREB, S133A-KCREB and S133A/R314A -CREB before and after TGFβ treatment.
2025-02-05 | GSE276922 | GEO
Project description:Hepatocarcinoma is the third leading cause of death in cancer in the world. In recent years, research on CREB in hepatocellular carcinoma has become a hotspot, so our research group wants to use the mass spectrometry analysis what proteins can bind with CREB, and then explore the links between CREB and hepatocellular carcinoma.
2019-11-08 | PXD008261 | Pride