Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Zebrafish embryos: hdac1 Morphants vs Standard control morphants

ABSTRACT: Transcriptional profiling of hdac1 morphant zebrafish embryos in comparison to standard control injected embryos. Embryos where injected at the one cell stage with either a translation blocking morpholino (Hdac1 ATG), splice blocking morpholino (Hdac1 Splice) or Hdac1 mismatch control morpholino (Hdac1 control). RNA was extracted and compared in a two-colour hybridisation to the comman reference Standard control morpholino injected embryos.

ORGANISM(S): Danio rerio

PROVIDER: GSE26708 | GEO | 2011/01/21

SECONDARY ACCESSION(S): PRJNA142141

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Similar Datasets

Zebrafish embryos: hdac1 Morphants vs Standard control morphants

Project description:Transcriptional profiling of hdac1 morphant zebrafish embryos in comparison to standard control injected embryos. Embryos where injected at the one cell stage with either a translation blocking morpholino (Hdac1 ATG), splice blocking morpholino (Hdac1 Splice) or Hdac1 mismatch control morpholino (Hdac1 control). RNA was extracted and compared in a two-colour hybridisation to the comman reference Standard control morpholino injected embryos. Common reference experiment, hdac1 morphants vs. standard control morphants. Biological replicates: 2 (except Splice which was technical rather than biological)

2011-01-21 | E-GEOD-26708 | biostudies-arrayexpress

Zebrafish embryos: hdac1 Morphants vs Standard control morphants at 12, 18 and 27 hpf

Project description:Transcriptional profiling of hdac1 ATG morphant zebrafish embryos in comparison to standard control injected embryos. Embryos where injected at the one cell stage with either a translation blocking morpholino (Hdac1 ATG) or Standard control morpholino (StCo). RNA was extracted at 12, 18 and 27hpf from both sets of embryos and compared with a two-colour hybridisation.

2011-01-21 | GSE26709 | GEO

Zebrafish embryos: hdac1 Morphants vs Standard control morphants at 12, 18 and 27 hpf

2011-01-21 | E-GEOD-26709 | biostudies-arrayexpress

Transcriptional profiling of setb morphants

Project description:We have characterised the zebrafish ortholog, setb, and investigated its role in embryogenesis. Phylogenetic analysis showed that zebrafish Setb has an amino acid sequence identity of approximately 96% with the mammalian orthologs. Whole mount immunofluorescence analysis revealed that Setb is expressed mainly in the eye, the lateral line neuromasts and the olfactory pit. Knockdown of setb using antisense morpholino oligonucleotides resulted in increased apoptosis, reduced cell proliferation and severe morphological defects. The morphant phenotypes were partially rescued when setb MO1 was co-injected with human set mRNA. In vivo labelling of hair cells in the lateral line of setb morphants with the vital fluorescent dye FM1-43 showed a significant decreased number of functional neuromasts. Gene expression analysis of setb morphants, employing DNA microarrays revealed a role of Setb in neurogenesis and the mechanosensory lateral line system. 48hpf control morpholino- and setb MO1-injected embryos in triplicates

2016-06-01 | E-GEOD-70049 | biostudies-arrayexpress

Analysis of miRNA abundance lin28 knockdown Xenopus embryos at late gastrula stage 13

Project description:The abundance of miRNAs in Xenopus tropicalis embryos injected with a standard control morpholino oligo at early gastrula stage 13 was compared to that in sibling embryos in which the RNA binding proteins lin28a1, lin28a2 and lin28b have been knocked down by injection of translation blocking antisense morpholino oligos. A dual colour array system is used for analysis. n Expression levels are determined relative to a common, pooled mixed developmental stage RNA sample.

2015-10-31 | E-MTAB-3939 | biostudies-arrayexpress

Transcriptional effects of glucocorticoid receptor alpha and beta signaling in zebrafish

Project description:The glucocorticoid receptor (GR) regulates gene expression upon activation by glucocorticoid (GC) hormones. In zebrafish, two GR splice variants exist: the canonical GR M-NM-1-isoform (GRM-NM-1), and the GR M-NM-2-isoform (GRM-NM-2). The exact function of GRb remains elusive. We have investigated the transcriptional role of GRa and GRb in the zebrafish embryo model by injecting mebryos with two splice-blocking morpholinos (one leading to knockdown of both GR M-NM-1- and M-NM-2-isoforms, and another targeting the alternative splicing of the GR pre-mRNA in favor of the GR M-NM-2-isoform) and with GRM-NM-2 mRNA (resulting in specific GRM-NM-2 overexpression). Transcriptome profiling was performed on total RNA isolated from 30 hpf embryos. Our results show that GRb does not act as a dominant-negative inhibitor of GRa, and that GRa regulates two distinct gene clusters, which are mainly involved in the metabolism of the embryo. This microarray study was designed to determine the effect of knockdown and overexpression of GRa and GRb. For this purpose, wild type (AB/TL) zebrafish embryos were injected at the 1-2 cell stage with a standard control morpholino (SC-MO), a splice-blocking morpholino leading to knockdown of both GR M-NM-1- and M-NM-2-isoforms (MO1), a splice-blocking morpholino targeting the alternative splicing of the GR pre-mRNA in favor of the GR M-NM-2-isoform (MO2), or GRb mRNA. At 24 hpf, each group was treated with dexamathasone (or vehicle) for 6 hr. This resulted in 8 treament groups: SC-MO/veh, SC-MO/dex, MO1/veh, MO1/dex, MO2/veh, MO2/dex, GRb mRNA/veh, GRb mRNA/dex. After the incubation period, embryos were collected and RNA was isolated from 20 embryos per treatment group (30 hpf). Three individual experiments were performed, and the resulting triplicate samples were analyzed by microarray, using a common reference approach.

2014-11-18 | E-GEOD-63360 | biostudies-arrayexpress

Transcriptional profiling of setb morphants

2016-06-01 | GSE70049 | GEO

Pair wise comparison between STD-MO and klf4-MO embryos

Project description:Direct pairwise comparison of the differential expression patterns between embryos injected with Standard olignucleotide morpholinoes and those injected with an anti-klf4 morpholino. Keywords: Direct pairwise comparison

2008-08-01 | GSE8656 | GEO

Identification of differentially-expressed genes between FoxH1 morpholino and control in zebrafish embryos.

Project description:The Forkhead Box H1 (FoxH1) protein is a co-transcription factor recruited by phosphorylated Smad2 downstream of several TGFbetas, including Nodal-related proteins. We have reassessed the function of zebrafish FoxH1 using antisense morpholino oligonucleotides (MOs) ( 5’ TGCTTTGTCATGCTGATGTAGTGGG 3’) as compared with a control morpholino (MO) with no specific target (5’ TAGTTAAGCCTAGCTCTCATAAACT 3’). Probing FoxH1 morphant RNA by microarray, we identified a cohort of five keratin genes – cyt1, cyt2, krt4, krt8 and krt18 - that are normally transcribed in the embryo’s enveloping layer (EVL) and which have significantly reduced expression in FoxH1-depleted embryos. Keywords: 40% epiboly-stage embryos, injected with either 8 ng of a 25mer morpholino (MO) with no specific target or 8 ng of a 25mer MO with reverse complementary to the 5’ untranslated region of the zebrafish foxH1 gene.

2007-07-30 | GSE8076 | GEO

Xenopus laevis embryos and animal caps: Control vs PouV morpholino

Project description:Transcriptional profiling of Xenopus laevis embryos and ectoderm (animal caps) comparing embryos injected with control morpholino with embryos injected with the morpholino mixture PVD2, which knocks down all three Xenopus PouV proteins. Whole embryos (WE) or animal caps (AC) were collected at late blastula (9) or early gastrula (10) stages from Control and PVD2 morphants.

2013-11-12 | GSE47578 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data