Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Control of bioenergetic balance in mouse spermatogonial stem cells by alanine metabolism

ABSTRACT: GS cell culture medium contains glucose, lactate and pyruvate. To understand the role of pyruvate in the culture medium, we tested the effect of each of these compounds on proliferation on laminin-coated dishes and compared gene expression levels by RNA-seq.

ORGANISM(S): Mus musculus

PROVIDER: GSE271429 | GEO | 2026/07/01

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Control of bioenergetic balance in mouse spermatogonial stem cells by alanine metabolism

Project description:Control of bioenergetic balance in mouse spermatogonial stem cells by alanine metabolism

| PRJNA1131380 | ENA

RNA-seq in WTC11 i3 lower-motor neurons with and without TDP-43 knockdown

Project description:Nuclear depletion and cytoplasmic aggregation of the RNA-binding protein TDP-43 is the hallmark of ALS, occurring in over 97% of cases. A key consequence of TDP-43 nuclear loss is the de-repression of cryptic exons. Motor neurons are the vulnerable cell-type in ALS and cryptic exons show variability in expression by cell-type. A human induced pluripotent stem cell (iPSC) line (WTC11), stably expressing a doxycycline-inducible hNIL construct and CRISPR/Cas9 was used in this study. Differentiation of human iPSCs was performed as previously reported. Briefly, iPSC induction was achieved using induction medium containing DMEM/F12, GlutaMAX supplement medium (Thermo Fisher), MEM non-essential amino acids (Thermo Fisher), N2 supplement (Thermo Fisher), 0.2 mM compound E, 2 μg/ml doxycycline, Pen/Strep and 10 μM Y-27632. After induction for 48 h, cells were dissociated from plates by Accutase and reseeded on poly-D-lysine (PDL)/laminin-coated tissue culture dishes or microfluidic devices in induction medium supplemented with 1 μg/ml laminin. After 24 h, induction medium was replaced by motor neuron medium containing Neurobasal (Thermo Fisher), B27 Plus supplement (Thermo Fisher), N2 supplement, Culture One supplement (Thermo Fisher), 1 μg/ml laminin, 2 μg/ml doxycycline, and Pen/Strep. Medium change was performed every 1-3 days. To achieve knockdown, sgRNAs targeting TARDBP (GGGAAGTCAGCCGTGAGACC) were delivered to iPS cells by lentiviral transduction.

2026-07-04 | E-MTAB-15433 | biostudies-arrayexpress

A bioenergetic shift is required for spermatogonial differentiation.

Project description: Not available

| S-EPMC7431567 | biostudies-literature

MicroRNA profiling by array of mouse skeletal muscle cells treated with TNF-alpha or IGF-I

Project description:Murine skeletal muscle cells pmi28 were cultured in growth medium (HamM-^Rs F10, supplemented with 20 % FCS, 2 mM L-glutamine, and 1 % Penicillin / Streptomycin). Myoblasts were cultured on laminin-1 coated dishes for an additional 24 h before switching a fraction of dishes to differentiation medium (DMEM medium containing 2 % horse serum, 2 mM L glutamine, and 1 % Penicillin / Streptomycin) and to differentiation medium containing either 2 x 103 U/ml mouse recombinant TNF-? (Roche Applied Science), or 5 M-5g/ml mouse recombinant IGF-I (Sigma-Aldrich), or carrier only. pmi28 cells (TNF-? and IGF-I treatments as well as controls) were harvested 24 h after the induction of differentiation. The experiments were performed in quadruplicates or triplicates, respectively.

2013-05-15 | E-MTAB-1114 | biostudies-arrayexpress

A bioenergetic shift is required for spermatogonial differentiation

Project description:A bioenergetic balance between glycolysis and mitochondrial respiration is particularly important for stem cell fate specification. It however remains to be determined whether undifferentiated spermatogonia switch their preference of bioenergy production during differentiation. In this study, we found that ATP generation in spermatogonia was gradually increased upon retinoic acid-induced differentiation. To accommodate this elevated energy demand, retinoic acid signaling concomitantly switched ATP production in spermatogonia from glycolysis to mitochondrial respiration, accompanied by increased levels of reactive oxygen species. In addition, inhibition of glucose conversion to glucose-6-phosphate or pentose phosphate pathway blocked the formation of c-Kit+ differentiating germ cells, suggesting that metabolites produced from glycolysis are required for spermatogonial differentiation. We further demonstrated that the expression levels of several metabolic regulators and enzymes were significantly altered upon retinoic acid-induced differentiation by both RNA-seq analyses and quantitative proteomics. Taken together, our data unveil a critically regulated bioenergetic balance between glycolysis and mitochondrial respiration which is required for spermatogonial proliferation and differentiation.

2021-09-09 | PXD019136 | Pride

Neural Committed Progenitors SAGE library

Project description:After 10-12 days in culture as neurospheres, the cells were cultured and plated on 5ug/ml poly-L-ornithine (1 hr RT, dry) and 10ug/ml laminin (O/N 4degC, dry) in stem cell differentiation medium. The cells were harvested 2 days later. Keywords: other

2005-12-09 | GSE3782 | GEO

Transcription profiling of mouse embryonic stem cell line Sox1Tv2 during neuronal differentiation

Project description:This experiment is part of the FunGenES project (FunGenES - Functional Genomics in Embryonic Stem Cells partially funded by the 6th Framework Programme of the European Union, http://www.fungenes.org). The experiment was conducted at Aventis Pharma, Paris, France. Goal of the experiment is the characterisation of gene expression profile during neuronal differentiation of Sox1Tv2 ES cells in the embryoid body protocol. Materials and methods:Sox1Tv2-E14 derived ES cells have been cultured without serum in liquid culture in order to form embryoid bodies. A 48 hour retinoic acid stimulation has been applied between days 4 and 6 (EB6) for half the samples. After 8 days of differentiation (EB8), EBs have been dissociated and cells plated on poly-D-lysine/laminin coated dishes and cultured in differentiation medium. bFGF has been added to the culture medium during the first 2 days after plating (N2). After removal of bFGF, cells were allowed to differentiate for 4 more days (N6). Protocol described in FunGenES handbook. Relationships between samples: Different time points during differentiation process: ES, EB3, EB4, EB6 (ctl and RA), EB8 (ctl and RA), N2 (ctl and RA), N6 (ctl and RA),Treatments: Retinoic acid treatment: EB4 to EB6bFGF addition (10ng/ml final): postplating to N2. Culture conditions: Liquid medium culture: GMEM + KOSR Differentiation medium: DMEM/F12 and NBM medium with N2 and B27 supplements.

2009-07-10 | E-TABM-669 | biostudies-arrayexpress

Transcription profiling of laminin binding and laminin non-binding germ cells to define the spermatogonial stem cells.

Project description:Comparison of laminin binding and laminin non-binding germ cells.

2007-12-19 | E-GEOD-829 | biostudies-arrayexpress

Expression data from RNAi knockdown HeLa cells

Project description:One day before transfection, HeLa cells were seeded in 6-well culture plates (1.5 x 10e5 cells per well) or 10-cm culture dishes (4.3 x 10e5 cells per dish). siRNA duplex (at a final concentration in culture medium of 30 nM) was transfected with Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. siRNA duplices specific for human hnRNP L, human hnRNP LL, and luciferase GL2 were from MWG Biotech (Ebersberg, Germany). Keywords: control / knockdown comparison

2007-12-01 | GSE8945 | GEO

RNA-seq analysis of mESCs cultured on either Laminin-511 or gelatin coated dishes in either Std or 2i medium

Project description:RNA-seq analysis of mESCs cultured on either Laminin-511 or gelatin coated dishes in either Std or 2i medium

| PRJNA548638 | ENA