Canary Ovarian Cell Line Gene Expression
Ontology highlight
ABSTRACT:
ORGANISM(S): Homo sapiens
PROVIDER: GSE27225 | GEO | 2011/02/12
SECONDARY ACCESSION(S): PRJNA141969
REPOSITORIES: GEO
Similar Datasets
Project description:All cell lines were cultured according to the specifications outlined by ATCC. Cell lines were grown to 80% confluence, then serum-deprived in 0.5% FBS for 24 hours before harvesting. Cells were washed twice with Hank's Balanced Salt Solution (Invitrogen, Carlsbad, California) and drained. 1 mL of SDS extraction buffer (0.1M NaCl, 20 mM Trizma base, 25 mM EDTA, 0.5% w/v SDS) was added directly to the plate to lyse the cells. Cellular lysate was scraped off the plates, pipetted into a cryovial, and stored at 80C until DNA extraction. Lysates were treated with 200 ug/ml ProteinaseK at 50C overnight. DNA was precipitated with one volume of Isopropanol and dissolved in TE4 buffer. Cell lines were lysed in Phenol followed by a Phenol/Chloroform extraction. The aqueous layer was added to 70% ethanol and further purified by loading the RNA/Ethanol mix into an RNeasy Mini kit (Qiagen) column. Purification was continued and finalized as described in the RNeasy kit (Qiagen) Manual. We measured transcript levels in the 27 primary ovarian tumors and 15 cell lines using the HEEBO [16] oligonucleotide microarrays, containing 44,544 70-mer probes and printed at the Stanford Functional Genomics Facility. Detailed information on the HEEBO arrays is available at the Stanford Functional Genomics Facility website. Experimental methods. Microarray experiments were performed as described at the Brown lab website. Briefly, 500 ug of total RNA from each of the ovarian tumors were amplified using Amino Allyl Message Amp II aRNA Kit (Ambion, Austin, TX, USA). The aRNAs were labeled with Cy5 and co-hybridized with Cy3 labeled Stratagene reference aRNA. For some samples, the mRNA was amplified and hybridized in duplicate or triplicate. The samples were then hybridized to HEEBO microarrays. The arrays were scanned in a low-ozone environment using a GenePix 4000A microarray scanner and images were analyzed with Genepix 5.0 (Axon instruments, Union City, CA). Using regression correlation
2011-02-12 | E-GEOD-27225 | biostudies-arrayexpress
Project description:Ten male 4get mice were infected with N. brasiliensis and single-cell suspensions of total lung tissue were prepared 9 days after infection. Cells were stained for CD3, CD19, c-kit and CCR3 and sorted for CD3-CD19-c-kit-GFP+CCR3+SSChi (eosinophils) and CD3-CD19-c-kit- GFP+CCR3-SSClo (basophils) using a MoFlo high-speed cell sorter (Cytomation, Fort Collins, CO). Total RNA was isolated from 2 x 106 eosinophils and 1.75 x 105 basophils using the Total RNA Isolation Kit (Fluka, Buchs, Switzerland) and amplified by two rounds of in vitro transcription using the Amino Allyl MessageAmpTM aRNA kit (Ambion, Austin, TX). Universal Mouse Reference RNA (#740100; Stratagene, La Jolla, CA) was amplified in the same way. Aminoallyl-UTP was incorporated during the second round of amplification and 5 µg of amplified RNA was coupled to Cy3 and Cy5 fluorescent dyes (CyScribeTM dye labeling kit, Amersham Biosciences, Peapack, NJ). Probes were hybridized to spotted glass oligonucleotide (70-mer) arrays which cover just over 16,400 unique genes (Mouse Genome Set Version 2.0, Qiagen, Germany). The arrays were prehybridized in 1% BSA (Invitrogen), 5 x SSC, 0.1% SDS for 2 hr at 42°C, washed in water and hybridized with the Cy3/Cy5-labeled probes in 2.8 x SSC, 0.2% SDS, 0.6 mg/ml Cot-1 DNA (Invitrogen), and 0.8 mg/ml yeast tRNA, at 63°C for 45 hr. Slides were washed sequentially in 0.03%SDS/1 x SSC, 0.2 x SSC and 0.05 x SSC, dried and scanned on an Axon 4000B scanner using Genepix 3.0 software (Axon Instruments, Inc.). Data were normalized using the R package Bioconductor software and ?lowess? normalization on the pixel medians without background subtraction (Ihaka and Gentleman, 1996). Keywords = Eosinophils Keywords = Basophils Keywords = Nippostrongylus Keywords = Lung Keywords = Type 2 immunity Keywords: other
2004-02-21 | GSE984 | GEO
Project description:To measure the relative changes of gene expression upon Gis2p depletion, 50 ml of delta Gis2 cells or the respective wild-type strain BY4741 were grown in YPD at 30 degrees celsius to an OD600 of 0.5- 0.6. Cells were harvested by centrifugation and washed twice with 5ml of bidistilled water (ddH2O). RNA was isolated by hot phenol extraction for microarray analysis. 20 ug of total RNA derived from wild-type and knock-out cells were reverse transcribed in the presence of 5-(3-aminoallyl)-dUTP and natural dNTPs with a mixture of N9 and dT20V primers, and cDNAs were covalently linked to Cy3 and Cy5 NHS-monoesters (GE HealthSciences Cat# RPN5661), respectively, and competitively hybridized onto yeast oligo arrays at 42 degrees celsius for 14 hours in formamide-based hybridization buffer. Microarrays were scanned with an Axonscanner 4200 (Molecular Devices) and analyzed with GenePix Pro 5.1 (Molecular devices) before uploading into Stanford Microarray Database.
2010-12-22 | GSE24004 | GEO
Project description:Total RNA was extracted from skin biopsies before and after imatinib (Gleevec) treatment using Qiagen RNeasy fibrous tissue kit. RNA was amplified using the Ambion Amino Allyl MessageAmp II aRNA kit. Amplified skin RNA (labeled with Cy5) and amplified Stratagene Human Universal Reference RNA (labeled with Cy3) were competitively hybridized to HEEBO microarrays in duplicate as described (http://www.microarray.org/sfgf/heebo.do). 161a/b: Patient 1, pre-Gleevec treatment 170a/b: Patient 1, post-Gleevec treatment 215a/b: Patient 2, pre-Gleevec treatment 232a/b: Patient 2, post-Gleevec treatment A compound treatment design type is where the response to administration of a compound or chemical (including biological compounds such as hormones) is assayed. Compound Based Treatment: Treated with 100 mg Gleevec twice daily for 3 months or 200 mg Gleevec daily for 6 months Keywords: compound_treatment_design
2009-03-31 | GSE11130 | GEO
Project description:Single-stranded oligos listed below (and the corresponding reverse compliment) were synthesized and annealed: E2F: CTAGATTTCCCGCGGATC (decoy); CTAGACTCTGCTCGGATC (scrambled) KTGGYRSGAA: CTAGATTCCCGCCAAGGATC (decoy); CTAGACAGCTACTCCGGATC (scrambled) TGCGCANK: CTAGACATGCGCAGGATC (decoy); CTAGATCACAGGCGGATC (scrambled) CCAATNNSNNNGCG: CTAGACGCCCTCCGATTGGGGATC (decoy); CTAGATGCACGCTCGGTCCGGATC (scrambled) ACTWSNACTNY: CTAGAGGAGTTGTAGTGGATC (decoy); CTAGAGATAGTGTGTGGGATC (scrambled) HeLa cells were propagated in DMEM (Invitrogen) plus 10% FBS and transfected with 0.5 uM of double-stranded DNA. Total RNA was extracted with TRIzol (Invitrogen) from HeLa cells 2 d after transfection of the indicated decoy oligo or scrambled oligo in duplicate. RNA was amplified using the Ambion Amino Allyl MessageAmp II aRNA kit. For each motif, decoy oligo transfected samples (labeled with Cy5) and the corresponding scrambled oligo transfected samples (labeled with Cy3) were competitively hybridized to HEEBO microarrays as described (http://www.microarray.org/sfgf/heebo.do).
2012-08-23 | GSE39572 | GEO
Project description:Confluent passage-2 HUVECs in Falcon T12.5 flasks grown in the presence or absence of VEGF-165 (10ng/mL) (R&D systems) were treated with human native, cleaved or latent antithrombins (20 5g/mL) for 24 hours in 3 mL M-199 with 2% heat-inactivated FBS and antibiotics. Following this treatment, total RNA was extracted from the cells by the Trizol method (Invitrogen). The total RNA was subjected to one cycle of linear RNA amplification using the MessageAmp aRNA kit according to the manufacturers instructions (Ambion, Austin, TX). The quality of the antisense RNA was verified on a denaturing agarose gel. Only samples showing a distribution of sizes from 250-5500 nt with a peak centered at 1000-1500 nt were used to generate the test cDNA samples for the subsequent array experiments. DNA labeling and hybridizations were performed essentially as described (Pollack et al., 1999, Nat. Genet.), with slight modifications. Briefly, the test endothelial cell antisense RNA samples together with Universal Human Reference RNA (Stratagene, Cedar Creek, TX) were used to generate Cy3/Cy5 (Amersham Biosciences) labeled cDNA for array hybridization on the Stanford 43K human cDNA microarray (www.microarray.org/sfgf). The Stanford microarray used in this study consists of 18,416 named genes with UniGene symbol, 4,145 ESTs with known function, 19,365 ESTs with unknown function and ~1,000 repeated spots as internal controls. Hybridized arrays were scanned on a GenePix 4000B scanner (Axon Instruments), and fluorescence ratios (test/reference) calculated using the Stanford Microarray Database software (available at http://genomewww5. A stimulus or stress experiment design type is where that tests response of an organism(s) to stress/stimulus. e.g. osmotic stress, behavioral treatment Keywords: Computed
2005-12-31 | GSE3956 | GEO
Project description:Comparison of wild-type (2.4.1) R. sphaeroides gene expression in 30% O2 aerobic respiration vs. photosynthesis 10W/m2 light, to identify candidate photosynthesis genes. RNA preparation: pellet cells from exponential phase cultures using 5% phenol in ethanol stop solution; lysozyme + SDS to lyse; phenol/chloroform extraction + DNase treatment + RNeasy kit clean up. Manuscript in preparation. The below normalized data was generated using GeneSpring software with the following settings: A data: Data Transformation: set all values less than 0.01 to 0.01 Per Chip: normalize to 50th percentile, and then Per Gene: normalize to median B data: Data Transformation: set all values less than 0.01 to 0.01 Per Chip: normalize to 50th percentile Values from independent replicates were averaged Keywords = Rhodobacter sphaeroides Keywords = photosynthesis Keywords = purple bacteria Keywords: other
2005-04-01 | GSE2145 | GEO
Project description:Ovarian tumor tissues were obtained from patients with informed consent, which was approved by the Institutional Review Board of the Swedish Hospital in Seattle. Tissue acquisition, processing and storage were conducted by the Pacific Ovarian Cancer Research Consortium (POCRC) at the Fred Hutchinson Cancer Research Center. The quality of tumor tissues, the percentage of cancer cells and the histological analysis of the tumors were determined via a centralized pathology review at the POCRC repository. All samples were distributed in a de-identified manner and cannot be traced back to patients. The tumor tissues were disrupted in a Biospec Tissue-Tearor Model 985370-395 in the presence of TRIzol (Invitrogen) with a ratio of 10ml TRIzol per 50mg of tissue. Following an extraction step of 0.2 ml of Chloroform per 1ml of TRIzol, the upper aqueous phase was removed for RNA isolation. The remaining inter-phase and the phenol phase was briefly stored in 4??C for DNA isolation. The upper aqueous phase was processed for total RNA according to Invitrogen protocol and further purified using RNeasy Mini kit (Qiagen). Genomic DNA was isolated by back-extraction from the TRIzol inter-phase and the phenol phase as described on Ambion website (page 4). Detailed amplification and labeling protocols are available at the Brown lab website
2011-02-12 | GSE27223 | GEO
Project description:MicroPoly(A)Pure kits (Ambion) were used to prepare mRNA from P. salmonis-infected and control Atlantic salmon macrophages. Infected and control (24 h incubation) macrophage mRNA samples were subjected to two rounds of amplification using the MessageAmp aRNA kit (Ambion) and manufacturer's instructions. Approximately 400 ng of macrophage mRNA was used as template in the first round of amplification, yielding 8.1 ug of infected macrophage aRNA and 7.8 ug of control macrophage aRNA. Approximately 1 ug of first-round macrophage aRNA was used as template in the second round of amplification, yielding 81.2 ug of infected macrophage aRNA and 83.3 ug of control macrophage aRNA. Infected and control macrophage aRNA samples were visualized on agarose gels to check quality and quantity. Except for the amounts of aRNA and reverse transcription (RT) primer used, macrophage target labeling reactions and microarray hybridizations were identical. Macrophage target syntheses used 5 ug of second-round aRNA and 5 ug of random primers (Roche). RT primers were mixed with aRNA samples, and nuclease-free H2O (Invitrogen) was added to make 10 ul total volume. Samples were incubated at 70 degrees C 4 min, then placed on ice. RT reactions included 50 mM Tris HCl pH 8.3, 75 mM KCl, 3 mM MgCl2, 10 mM DTT, 0.5 mM each dATP, dCTP, and dGTP, 0.2 mM dTTP, 0.05 mM Cy3-dUTP or Cy5-dUTP (Amersham), 40U RNAguard ribonuclease inhibitor (Amersham), and 400U Superscript II Rnase H- reverse transcriptase (Invitrogen). RT reactions were incubated at 42 degrees C for 2.5 h, followed by addition of 0.025U RNase A (Sigma) and 1.5U RNase H (New England BioLabs) and incubation at 37 degrees C for 30 min. Labeled targets were cleaned using the Qiaquick PCR purification kit (Qiagen) and precipitated, with 300 mM sodium acetate, 1 ul of 20 ug/ul glycogen (Invitrogen), and 2.5 volumes of 100% ethanol, at -20 degrees C overnight. Each labeled target was recovered by centrifugation (14,000 rpm, 4 degrees C, 1 h), washed in 70% ethanol, air-dried, and resuspended in 60 ul of hybridization buffer: 50% deionized formamide, 5X SSC, 0.1% SDS, 5 ul of 5 ug/ul oligo dT (5'T18[Q-N]3'), 5 ul of 2 ug/ul BSA (Pierce), and 2 ul of 10 ug/ul sonicated human placental DNA (Sigma). Targets were incubated at 96 degrees C for 3 min, and then at 65 degrees C until applied to microarrays. Microarrays were prepared for hybridization by washing 2 X 5 min in 0.1% SDS, washing 5 X 1 min in MilliQ H2O, immersing 3 min in 95 degrees C MilliQ H2O, and drying by centrifugation (2000 rpm, 5 min, in 50 ml conical tube). Microarray hybridizations were run in the dark under HybriSlips hybridization covers (Grace Biolabs) in slide hybridization chambers (Corning) submerged in a 45 degrees C water bath for 16 h. Coverslips were floated off in 45 degrees C (1X SSC, 0.2% SDS), and arrays were washed 1 X 10 min in 45 degrees C (1X SSC, 0.2% SDS), 3 X 4 min in room temperature (0.1X SSC, 0.1% SDS), and 4 X 4 min in room temperature 0.1X SSC. Slides were dried by centrifugation as before. Fluorescent images of hybridized arrays were acquired immediately at 10 um resolution using ScanArray Express (PerkinElmer). The Cy3 and Cy5 cyanine fluors were excited at 543 nm and 633 nm respectively, and the same laser power (90%) and photomultiplier tube (PMT) settings were used for all slides in a study (PMT 72 Cy3, PMT 63 or 64 Cy5 for macrophage study). Fluorescent intensity data were extracted from TIF images using Imagene 5.5 software (Biodiscovery). Keywords: other
2004-02-11 | GSE1012 | GEO
Project description:Patient Selection: Three hospitals were involved in the study: Dong Thap Provincial and An Giang Provincial hospitals, both located in the Mekong Delta Region of Vietnam where most of the Typhoid patients were admitted, and the Hospital for Tropical Diseases, Ho Chi Minh City, where the malarial patients were admitted. Infection status of each patient was determined by blood culture for the Typhoid patients and by microscopic examination of stained thick and thin peripheral-blood slides for the patients suspected of having Malaria. Patients with blood cultures positive for S. Typhi or S. enterica serovar Paratyphi A (S. Paratyphi A) (samples designated ST) or peripheral blood smears positive for Plasmodium falciparum or Plasmodium vivax (samples designated PF) were consented and enrolled in the study. A total of 28 S. Typhi positive patients and one S. Paratyphi A positive patient were enrolled in the first phase of the study and a further 9 S. Typhi and one S. Paratyphi A positive patient were enrolled in the second phase. Nine patients with Malaria caused by P. falciparum and one caused by P. vivax were enrolled. Sixteen uninfected healthy individuals (samples designated HC) were also enrolled in the study (one sample each). The Typhoid patients were randomly chosen to receive either Azithromycin or Gatifloxicin (20mg/kg/day for 7 days) antibiotics. Uncomplicated malaria patients were treated for 3 days with Artekin (dihydroartemisinin with piperaquine phosphate). Venous blood (2.5ml) was collected for total RNA extraction into PaxGene RNA collection tubes (Qiagen) at various times. The first sample (T1) was taken immediately on admission or entry into the study, then samples were collected, 3 (T3), 6-9 (T9 for Typhoid, T7 for Malaria), and 28-45 (T28) days following entry into the study and an average of 9 months (T9M) later. The PaxGene tubes were stored at 4degC until RNA was extracted as per the manufacturers instructions. Purified RNA was shipped on dry ice to Stanford University, CA for use in Microarray analyses. Microarrays: Experimental and reference samples (Human Universal RNA reference {Stratagene}) were amplified using the MessageAmp II aRNA Kit (Ambion) as per the manufacturer's instructions. Four micrograms amplified RNA was labeled through indirect incorporation of Cy5 (experimental) and Cy3 (reference) dyes (protocols can be found at http://cmgm.stanford.edu/pbrown/protocols/index.html). The labeled probes were then mixed and hybridized to Stanford Human cDNA arrays with 42 K features. Arrays were scanned using a Genepix 4000A laser scanner and data extracted with Genepix Pro Software version 5.1 (Axon Instruments). The data were then uploaded into the Stanford Microarray Database (SMD). A disease state experiment design type is where the state of some disease such as infection, pathology, syndrome, etc is studied. Compound Based Treatment: Drugs used for treatment Disease State: Malaria, Typhoid or Healthy Controls Keywords: disease_state_design
2010-01-04 | GSE7000 | GEO