Effect of depletion of Kdm5a on gene expression of zebrafish
Ontology highlight
ABSTRACT:
ORGANISM(S): Danio rerio
PROVIDER: GSE280830 | GEO | 2025/12/09
REPOSITORIES: GEO
Similar Datasets
Project description:Effect of depletion of Kdm5a on gene expression of zebrafish
| PRJNA1180635 | ENA
Project description:Gene expression profiles of Immortalized KDM5A-/- MEFs with re-introduction of wild-type KDM5A or KDM5A-H483A mutant.
2017-02-08 | GSE84309 | GEO
Project description:KDM5A-KO HEK293T cells were purchased from Beyotime (Shanghai, China). These KDM5A-KO HEK293T cells are polyclonal cells infected with lentivirus expressing the single guide RNA (sgRNA) and Cas9 and containing a puromycin resistance cassette and were characterized via a T7EI assay. The sgRNA sequence used to generate the KDM5A-KO cells was TCTCCGCCAAAGGCCGGATG. The sequences of the PCR primers specific for KDM5A were as follows: forwards, 5’CTTCAGCCAGCTTTTCTCCA3’; and reverse, 5’TCAGTTCCCAAGTTCTAGGC3’. H3k4me3(CST) cut&tag was performed for further analysis.
2025-12-09 | GSE299191 | GEO
Project description:Purpose: Identify zebrafish microglia transcriptome in the healthy and neurodegenerative brain. Methods: RNA sequencing was performed on FACS-sorted microglia (3x), other brain cells (3x) and activated microglia (4x). Microglia activation was induced using nitroreductase-mediated cell ablation. 10-20 million reads per sample were obtained. Reads were mapped to zebrafish genome GRC10. Results: We identified the zebrafish microglia transcriptome, which shows overlap with previously identified mouse microglia transcriptomes. Transcriptomes obtained 24h and 48h after treatment appeared highly similar. Therefore, these datasets were pooled. Additionally, we identified an acute proliferative response of microglia to induced neuronal cell death.
2016-10-20 | GSE86921 | GEO
Project description:We report the identification of genomic regions bound by KDM5A in mouse embryonic stem (ES) cells and define the functional categories that these regions represent. KDM5A modifies methylated lysine residues on histone tails. We developed anti-KDM5A antibodies and set to detect genomic regions enriched with these antibodies using cells with normal Kdm5a or cells from Kdm5a knockout mice as a control. We found high enrichment with the KDM5A antibodies in normal cells when compared with the genomic background. We found striking identity in the regions enriched with these antibodies in normal cells when compared with the total genomic DNA or with KDM5A ChIP assays from Kdm5a KO cells, showing that the antibodies are specific. Examination of target genes in ES cells
2012-10-04 | E-GEOD-28343 | biostudies-arrayexpress
Project description:GNE Myopathy is a rare, recessively inherited neuromuscular worldwide disorder, caused by a spectrum of bi-allelic mutations in the human GNE gene. GNE encodes a bi-functional enzyme responsible for the rate-limiting step of sialic acid biosynthesis pathway. However, the process in which GNE mutations lead to the development of a muscle pathology is not clear yet. Cellular and mouse models for GNE Myopathy established to date have not been informative. Further, additional GNE functions in muscle have been hypothesized. In these studies, we aimed to investigate gne functions using zebrafish genetic and transgenic models, and characterized them using macroscopic, microscopic, and molecular approaches. We first established transgenic zebrafish lineages expressing the human GNE cDNA carrying the M743T mutation, driven by the zebrafish gne promoter. These fish developed entirely normally. Then, we generated a gne knock-out (KO) fish using the CRISPR/Cas9 methodology. These fish died 8-10 days post-fertilization (dpf), but a phenotype appeared less than 24 hours before death and included progressive body axis curving, deflation of the swim bladder and decreasing movement and heart rate. However, muscle histology uncovered severe defects, already at 5 dpf, with compromised fiber organization. Sialic acid supplementation did not rescue the larvae from this phenotype nor prolonged their lifespan. To have deeper insights into the potential functions of gne in zebrafish, RNA sequencing was performed at 3 time points (3, 5, and 7 dpf). Genotype clustering was progressive, with only 5 genes differentially expressed in gne KO compared to gne WT siblings at 3 dpf. Enrichment analyses of the primary processes affected by the lack of gne also at 5 and 7 dpf point to the involvement of cell cycle and DNA damage/repair processes in the gne KO zebrafish. Thus, we have established a gne KO zebrafish lineage and obtained new insights into gne functions. This is the only model where GNE can be related to clear muscle defects, thus the only animal model relevant to GNE Myopathy to date. Further elucidation of gne precise mechanism-of-action in these processes could be relevant to GNE Myopathy and allow the identification of novel therapeutic targets.
2022-10-26 | GSE207593 | GEO
Project description:We perfomed ChIP-seq using KDM5A antibodies in T47D cells after 24 hour treatment with the AKT inhibitor MK2206 or DMSO. We show that the cistrome of the H3K4 demethylase KDM5A is affected by AKT inhibition. Comparison of genome-wide KDM5A binding after AKT inhibition vs vehicle
2016-06-14 | E-GEOD-80593 | biostudies-arrayexpress
Project description:Cells lacking Rb1 are deficient in differentiation. Loss of Kdm5a rescues myogenic differentiation, as judged by appearance of morphologically normal myotubes that display expression of late markers of differentiation. In order to better understand how Kdm5a loss rescues differentiation, we induced mouse embryonic fibroblasts (MEFs) of different genotypes to undergo myogenic differentiation and analyzed gene expression changes in wild-type, Kdm5a-/-, Rb1-/- and Kdm5a-/-; Rb1-/- cells. Rb1-/- cells stained single nucleated, did not exhibit morphological changes and increased expression of the myogenic marker MYHC. Except for Rb1-/- cells, all other cells were undergoing successful convertion into aligned multinucleated myotubes and were MYHC-positive. We obtained purified populations of myotubes for the wild-type and Kdm5a-/-; Rb1-/- cells. RNA-seq analysis of gene expression in Rb1 or Kdm5a deficient MEFs that were induced for myogenic differentiation.
2015-08-12 | E-GEOD-53528 | biostudies-arrayexpress
Project description:To understand the effects of Hsp60 deficiency in developing vertebrates, we generated CRISPR/Cas9-mediated hspd1 knockout zebrafish lines by targeting exon 2 to induce a frameshift mutation. We selected an allele with a 56 base pair deletion inducing a frameshift mutation leading to loss of protein functions. We examined the proteome changes in zebrafish larvae at 5 days post fertilization (DPF). Wildtype control and hspd1-/- larvae at 5dpf, were analyzed by TMT and nanoLC-MS/MS based proteomcis. For this purpose, we studied five pools from each genotype, and each pool consisted of five larvae.
2024-09-27 | PXD048920 | Pride
Project description:Nucleoporin 98 (NUP98) fusion oncoproteins are strong drivers of pediatric acute myeloid leukemia (AML) with poor prognosis. Here we show that NUP98 fusion-expressing AML harbors an epigenetic signature that is characterized by increased accessibility of hematopoietic stem cell genes and enrichment of activating histone marks. We employ an AML model for ligand-induced degradation of the NUP98::KDM5A fusion oncoprotein to identify epigenetic programs and transcriptional targets that are directly regulated by NUP98::KDM5A through CUT&Tag and nascent RNA-seq. Orthogonal genome-wide CRISPR/Cas9 screening identifies 12 direct NUP98::KDM5A target genes, which are essential for AML cell growth. Among these, we validate cyclin-dependent kinase 12 (CDK12) as a druggable vulnerability in NUP98::KDM5A-expressing AML. In line with its role in the transcription of DNA damage repair genes, small-molecule-mediated CDK12 inactivation causes increased DNA damage, leading to AML cell death. Altogether, we show that NUP98::KDM5A directly regulates a core set of essential target genes and reveal CDK12 as an actionable vulnerability in AML with oncogenic NUP98 fusions.
2025-02-17 | GSE255807 | GEO