Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

RNA-seq analysis of differentially expressed genes between WT and KD ZC3H18 KYSE150/ECA109 cells.

ABSTRACT: Small interfering RNAs (siRNAs) targeting ZC3H18 were purchased from Suzhou Hongxun Biotechnology Co., Ltd. (Suzhou, China), with an empty vector serving as the control (si-nc). ZC3H18 siRNA sequences were GGGGTGAGGGCTTCTGATCT and TCGTCGGAGTGATTATCTTCCT. These siRNAs were introduced into KYSE150 and ECA109 cells using DharmaFect1 (Suzhou Hongxun Biotechnology Co., Ltd., Suzhou, China).

ORGANISM(S): Homo sapiens

PROVIDER: GSE290209 | GEO | 2025/02/21

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

RNA-seq analysis of differentially expressed genes between WT and KD ZC3H18 KYSE150/ECA109 cells.

Project description:RNA-seq analysis of differentially expressed genes between WT and KD ZC3H18 KYSE150/ECA109 cells.

| PRJNA1226578 | ENA

RNA-Seq of LEF1 overexpression ECA109 cells

Project description:RNA-seq was performed on three biological replicates. Total RNA from ECA109 LV-GFP/LV-LEF1.Differentially expression genes were considered to be significant between groups when the P-value was <0.05 and the fold change of expression was ≥2-fold or ≤0.5-fold. By this way, the RNA-Seq data showed the differential expression genes in LEF1 overexpression ECA109 cells compared with NC cells. Furthermore, Gene ontology (GO) analysis was performed to facilitate elucidating the biological implications of the differentially expressed genes in the experiment. Pathway analysis was used to find out the significant pathway of the differentially expressed genes according to KEGG database. In conclusion, our study represents the first detailed analysis of LEF1 transcriptomes in esophageal squamous cell carcinoma cells.

2020-04-10 | GSE128914 | GEO

RNA-Seq of PRMT1 overexpression ECA109 cells

Project description:RNA-seq was performed on three biological replicates. Total RNA from ECA109 LV-GFP/LV-PRMT1.Differentially expressed genes were considered to be significant between groups when the P-value was <0.05 and the fold change of expression was ≥2-fold or ≤0.5-fold. By this way, the RNA-Seq data showed the differential expression genes in PRMT1 overexpression ECA109 cells compared with NC cells. Furthermore, Gene ontology (GO) analysis was performed to facilitate elucidating the biological implications of the differentially expressed genes in the experiment. Pathway analysis was used to find out the significant pathway of the differentially expressed genes according to KEGG database. In conclusion, our study represents the first detailed analysis of PRMT1 transcriptomes in esophageal squamous cell carcinoma cells.

2019-05-09 | GSE128913 | GEO

RNA-seq of Eca109 cells.

Project description:RNA-seq of Eca109 cells.

| PRJNA876710 | ENA

RNA-seq analysis of control and ZC3H18-depleted ovarian cancer cells

Project description:We report the differential gene expression in control versus ZC3H18-depleted OVCAR-8 cells

2019-08-29 | GSE136533 | GEO

RNA-Seq of LEF1 overexpression ECA109 cells

Project description:RNA-Seq of LEF1 overexpression ECA109 cells

| PRJNA529369 | ENA

RNA-Seq of PRMT1 overexpression ECA109 cells

Project description:RNA-Seq of PRMT1 overexpression ECA109 cells

| PRJNA529370 | ENA

circMAN1A2_009-pulled down proteins in HeLa cells

Project description:CircRNA pulldown assays were conducted to identify proteins interacting with circMAN1A2_009. In summary, HeLa cell protein extracts were incubated with biotin-labeled circMAN1A2_009 probes obtained from Tsingke Biotechnology, China, at room temperature for 1h. Subsequently, streptavidin magnetic beads were introduced into the cell lysates containing the probes and incubated overnight at 4°C. After three washes, proteins bound to the streptavidin magnetic beads were eluted using the Elution Buffer as per the instruction provided by the PierceTM Magnetic RNA-Protein Pull-Down Kit (Thermo, 20164, USA). The retrieved proteins underwent analysis through liquid chromatography-tandem mass spectrometry (LS-MS/MS) conducted by OE biotech Co. Ltd (Shanghai, China), or Western Blot.

2025-05-07 | PXD052372 | Pride

Dual agonistic and antagonistic roles of ZC3H18 provides for co-activation of distinct nuclear RNA decay pathways

Project description:The RNA exosome is a versatile ribonuclease. In the nucleoplasm of mammalian cells, it is assisted by its adaptors the Nuclear EXosome Targeting (NEXT) complex and the PolyA eXosome Targeting (PAXT) connection. Via its association with the ARS2 and ZC3H18 proteins, NEXT/exosome is recruited to capped and short unadenylated transcripts. Conversely, PAXT/exosome was considered to target longer and adenylated substrates via their poly(A) tails. Here, mutational analysis of the core PAXT component ZFC3H1 uncovers a separate branch of the PAXT pathway, which targets short adenylated RNAs and relies on a direct ARS2-ZFC3H1 interaction. We further demonstrate that similar acidic-rich short linear motifs of ZFC3H1 and ZC3H18 compete for a common ARS2 epitope. Consequently, while promoting NEXT function, ZC3H18 antagonizes PAXT activity. We suggest that this unprecedented organization of RNA decay complexes provides co-activation of NEXT and PAXT at loci with abundant production of short exosome substrates.

2024-01-26 | PXD045842 | Pride

Effect of depletion of USP36 on gene expression of ECA109 cells, esophageal squamous cell carcinoma cell line.

Project description:To investigate the function of USP36 in the regulation of cell proliferation and escc progression, we established eca109 cell lines in which each target gene has been knocked down by siRNA.We then performed gene expression profiling analysis using data obtained from RNA-seq of 6 different cells at same time points.

2023-01-04 | GSE206845 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data