Single-Tubule RNA-Seq Reveals Signaling regulated by phosphorylated T551/S552 on beta-catenin
Ontology highlight
ABSTRACT:
ORGANISM(S): Mus musculus
PROVIDER: GSE291074 | GEO | 2026/03/04
REPOSITORIES: GEO
Similar Datasets
Project description:Purpose: Experiments were done in mice undergoing unilateral nephrectomy (UNx) and sham nephrectomy. At specific time points (24 hours and 72 hours) after surgery, the earliest first portion of the kidney proximal tubule (PT-S1) and the cortical collecting duct (CCD) were manually micro-dissected and utilized for transcriptomic analysis by single-tubule small sample RNA-Seq. Methods: We carried out RNA-sequencing in microdissected ealiest portion of proximal tubules (PT-S1) or cortical collecting duct (CCD) from mice with or without (sham) unilateral nephrectomy (UNx). Each group (Sham or UNx) has 3-5 biological replicates. Results and conclusion: RNA-Seq in microdissected PT-S1 at 24 hours showed that peroxisome proliferator-activated receptor alpha (PPARα) target genes were strongly upregulated. RNA-Seq in microdissected PT-S1 at 72 hours showed that cell cycle related genes were strongly upregulated. RNA-Seq in microdissected CCD at both 24 hours and 72 hours showed that cell cycle related genes were strongly upregulated.
2022-08-14 | GSE211021 | GEO
Project description:The distal convoluted tubule (DCT) and the cortical collecting ducts (CCD) are portions of renal tubule that are partly responsible for maintaining the systemic concentrations of potassium, sodium, calcium and magnesium. Despite being structurally similar, DCT and CCD cells have different transport capabilities due to a variety of different membrane-associated transport proteins. However, DCT and CCD cells appear to be modulated via the same hormones. The objective of this study was assess the differential response of DCT and CCD cells to long-term exposure to the hormones vasopressin or angiotensin II, both of which modulate DCT and CCD cells differently. Mass spectrometry based quantitative proteomics was used to profile the differential proteome between DCT and CCD.
2017-12-15 | PXD005454 | Pride
Project description:We generated a spectral library of kidney cortical collecting ducts (CCD) using data-dependent proteomics acquisition.
2020-12-21 | PXD018795 | Pride
Project description:Purpose: Experiments were done in mice undergoing unilateral nephrectomy (UNx) and sham nephrectomy. At specific time points (24 hours and 72 hours) after surgery, the earliest first portion of the kidney proximal tubule (PT-S1) and the cortical collecting duct (CCD) were manually micro-dissected and utilized for transcriptomic analysis by single-tubule small sample RNA-Seq and single-tubule ATAC seq. Methods: We carried out ATAC-sequencing in microdissected ealiest portion of proximal tubules (PT-S1) from mice with or without (sham) unilateral nephrectomy (UNx). Each group (Sham or UNx) has 3 biological replicates. Results and conclusion: ATAC-seq peaks in microdissected PT-S1 revealed a predominance of binding site motifs corresponding to PPARα.
2022-08-14 | GSE211022 | GEO
Project description:Renal excretion of water and major electrolytes exhibits a significant circadian rhythm. This functional periodicity is believed to result, at least in part, from circadian changes in secretion/reabsorption capacities of the distal nephron and collecting ducts. Here, we studied the molecular mechanisms underlying circadian rhythms in the distal nephron segments, i.e. distal convoluted tubule (DCT) and connecting tubule (CNT) and, the cortical collecting duct (CCD). Temporal expression analysis performed on microdissected mouse DCT/CNT or CCD revealed a marked circadian rhythmicity in the expression of a large number of genes crucially involved in various homeostatic functions of the kidney. This analysis also revealed that both DCT/CNT and CCD possess an intrinsic circadian timing system characterized by robust oscillations in the expression of circadian core clock genes (clock, bma11, npas2, per, cry, nr1d1) and clock-controlled Par bZip transcriptional factors dbp, hlf and tef. The clock knockout mice or mice devoid of dbp/hlf/tef (triple knockout) exhibit significant changes in renal expression of several key regulators of water or sodium balance (vasopressin V2 receptor, aquaporin-2, aquaporin-4, M-oM-^AM-!ENaC). Functionally, the loss of clock leads to a complex phenotype characterized by partial diabetes insipidus, dysregulation of sodium excretion rhythms and a significant decrease in blood pressure. Collectively, this study uncovers a major role of molecular clock in renal function. Experiment Overall Design: We examined the temporal profiles of gene expression in mouse distal nephron segments and collecting ducts. The RNA was extracted from microdissected distal convoluted tubules and connecting tubules (DCT/CNT samples) or, cortical collecting ducts (CCD samples). Animals were sacrificed for microdissection every 4 hours, i.e. at ZT0, ZT4, ZT8, ZT12, ZT16 and ZT20 (ZT M-bM-^@M-^S Zeitgeber (circadian) time, indicates time of light-on as ZT0 and time of light-off as ZT12). The microarray hybridization was performed in duplicates on two pools of RNA composed of equivalent amounts of RNA prepared from five animals at each ZT time-point.
2009-10-30 | E-GEOD-17739 | biostudies-arrayexpress
Project description:Transcriptional profiling of FACS-sorted ureteric bud-derivative cells from Hoxb7CreGFP mice without floxed Bdkrb2 allele (WT) or with homozygously floxed Bdkrb2 alleles (MUT) at the age of postnatal one. Both WT and MUT mice have R26RTdTomato allele as a recombinase efficiency indicator, which allows the FACS to sort cells according to both GFP and TdTomato. This experiment aimed to uncover the genome-wide alternation in gene expression resulting from the removal of Bdkrb2 in the ureteric buds and their derivative collecting ducts.
2019-07-31 | GSE78906 | GEO
Project description:Isolated methylmalonic acidemia (MMA) is a pleiotropic enzymatic defect of branched-chain amino acid oxidation most commonly caused by deficiency of methylmalonyl-CoA mutase (MUT). End stage renal disease (ESRD) is emerging as an inevitable disease-related complication, recalcitrant to conventional therapies and liver transplantation. To establish a viable model of MMA-associated renal disease, methylmalonyl-CoA mutase (Mut) was expressed in the liver of Mut -/- mice as a stable transgene under the control of an albumin (INS-Alb-Mut) promoter. Mut -/- ;TgINS-Alb-Mut mice were rescued from the neonatal lethality displayed by Mut -/- mice and manifested a decreased glomerular filtration rate (GFR), chronic tubulointerstital nephritis (CTIN) and prominent ultrastructural changes in the proximal tubular mitochondria, replicating precisely the renal manifestations seen in a large MMA patient cohort.
2013-05-01 | GSE41044 | GEO
Project description:Renal excretion of water and major electrolytes exhibits a significant circadian rhythm. This functional periodicity is believed to result, at least in part, from circadian changes in secretion/reabsorption capacities of the distal nephron and collecting ducts. Here, we studied the molecular mechanisms underlying circadian rhythms in the distal nephron segments, i.e. distal convoluted tubule (DCT) and connecting tubule (CNT) and, the cortical collecting duct (CCD). Temporal expression analysis performed on microdissected mouse DCT/CNT or CCD revealed a marked circadian rhythmicity in the expression of a large number of genes crucially involved in various homeostatic functions of the kidney. This analysis also revealed that both DCT/CNT and CCD possess an intrinsic circadian timing system characterized by robust oscillations in the expression of circadian core clock genes (clock, bma11, npas2, per, cry, nr1d1) and clock-controlled Par bZip transcriptional factors dbp, hlf and tef. The clock knockout mice or mice devoid of dbp/hlf/tef (triple knockout) exhibit significant changes in renal expression of several key regulators of water or sodium balance (vasopressin V2 receptor, aquaporin-2, aquaporin-4, alphaENaC). Functionally, the loss of clock leads to a complex phenotype characterized by partial diabetes insipidus, dysregulation of sodium excretion rhythms and a significant decrease in blood pressure. Collectively, this study uncovers a major role of molecular clock in renal function. Keywords: time course
2009-10-22 | GSE17739 | GEO
Project description:Methylmalonic acidemia (MMA) is one of the most common inherited metabolic disorders, due to deficiency of the mitochondrial methylmalonyl ̶ coenzyme A mutase (MUT). How MUT deficiency triggers mitochondrial alterations and cell damage remains unknown, preventing the development of disease-modifying therapies. To assess the effect of MUT deficiency on gene expression we investigated the transcriptome of in kidney cells derived from healthy controls or patients with MMA who harbor inactivating mutations in MUT. Microarray data indicate that MUT deficiency induces a profound and global change in gene expression that may be in part responsible of cellular alterations observed in patient cells.
2019-10-01 | GSE120683 | GEO
Project description:The selected gRNA sequence is tggcatgtttattgagcgctTGG. To disrupt the demethylation motif RRACT in 2288-2290 of Foxo1 mRNA (NM_019739), a mutation (ttGGACT to ctCGATT) target vector was constructed with 1214bp 5’arm and 849bp 3’arm. Mouse zygotes obtained by mating of males with superovulated C57BL/6J females, were injected with a mixture of Cas9 mRNA (80 ng/μl), sgRNA (40 ng/ul) and Donor vector (8 ng/ul). Microinjections were performed into the male pronucleus of fertilized oocytes. Injected zygotes were transferred into pseudopregnant CD1 female mice, and viable adult mice were obtained. Mice were genotyped using sequencing and PCR. PCR primers: mut-F1, ATCCCCATTGAGCAGTAAGTTTTCCA; mut-R1, TGATGGACTCCATGTCACAATCGAG; mut-F2, GCATGTTTATTGAGCGCCTCGAT; mut-R2, CCGCTGTTGCCAAGTCTGAGG; wt-R1, TGATGGACTCCATGTCACAGTCCAA. PCR genotyping of wild-type (wt) and mutant (mut) mice was using primers mut-F1 and mut-R1 to generate fragments of 1291 bp for mut allele, using primers mut-F2 and mut-R2 to generate fragments of 930 bp for mut allele, and using primers mut-F1 and wt-R1 to generate fragments of 1291 bp for wt allele. Total RNA was isolated from Liver Tissue using the TRIzol (Invitrogen) reagent by following the company manual. For all samples the RNA integrity was checked using an Agilent Bioanalyzer 2100. Approximately 2.5 µg of total RNA was then used for library preparation using a TruSeq™ RNA Sample Prep Kit v2 (Illumina, San Diego, CA, USA) according to the manufacturer’s protocol.The libraries were sequenced using HiSeq3000 (Illumina) in paired-read mode, creating reads with a length of 101 bp. Sequencing chemistry v2 (Illumina) was used.
2022-01-26 | GSE125786 | GEO