Effect of deoxynivalenol and acrylamide on gene expression on IEC-6 intestinal cells
Ontology highlight
ABSTRACT:
ORGANISM(S): Rattus norvegicus
PROVIDER: GSE291848 | GEO | 2026/03/03
REPOSITORIES: GEO
Similar Datasets
Project description:Effect of deoxynivalenol and acrylamide on gene expression on IEC-6 intestinal cells
| PRJNA1235628 | ENA
Project description:Acrylamide is a type-2 alkene monomer with established human neurotoxic effects. While the primary source of human exposure to acrylamide is occupational, other exposure sources include food, drinking water, and smoking. In this study, neurobehavioral assays coupled with transcriptional profiling analysis were conducted to assess both behavioral and gene expression effects induced by acrylamide neurotoxicity in rats when administered during early postnatal life. Acrylamide administration in rat pups induced significant characteristic neurotoxic symptoms including increased heel splay, decrease in grip strength, and decrease in locomotor activity. Transcriptome analysis with the Affymetrix Rat Genome 230 2.0 array indicated that acrylamide treatment caused a significant alteration in the expression of genes involved in muscle contraction, pain regulation, and dopaminergic neuronal pathways. First, in agreement with the observed behavioral effects, expression of the Mylpf gene involved in muscle contraction was downregulated in the spinal cord in response to acrylamide. Second, in sciatic nerves, acrylamide repressed the expression of the opioid receptor gene Oprk1 that is known to play a role in neuropathic pain regulation. Finally, in the cerebellum, acrylamide treatment caused a decrease in the expression of the nuclear receptor gene Nr4a2 that is required for development of dopaminergic neurons. Thus, our work examining the effect of acrylamide at the whole-genome level on a developmental mammalian model has identified novel genes previously not implicated in acrylamide neurotoxicity that can be further developed into biomarkers for assessing the risk of acrylamide exposure.
2012-02-08 | GSE29004 | GEO
Project description:Acrylamide is a type-2 alkene monomer with established human neurotoxic effects. While the primary source of human exposure to acrylamide is occupational, other exposure sources include food, drinking water, and smoking. In this study, neurobehavioral assays coupled with transcriptional profiling analysis were conducted to assess both behavioral and gene expression effects induced by acrylamide neurotoxicity in rats when administered during early postnatal life. Acrylamide administration in rat pups induced significant characteristic neurotoxic symptoms including increased heel splay, decrease in grip strength, and decrease in locomotor activity. Transcriptome analysis with the Affymetrix Rat Genome 230 2.0 array indicated that acrylamide treatment caused a significant alteration in the expression of genes involved in muscle contraction, pain regulation, and dopaminergic neuronal pathways. First, in agreement with the observed behavioral effects, expression of the Mylpf gene involved in muscle contraction was downregulated in the spinal cord in response to acrylamide. Second, in sciatic nerves, acrylamide repressed the expression of the opioid receptor gene Oprk1 that is known to play a role in neuropathic pain regulation. Finally, in the cerebellum, acrylamide treatment caused a decrease in the expression of the nuclear receptor gene Nr4a2 that is required for development of dopaminergic neurons. Thus, our work examining the effect of acrylamide at the whole-genome level on a developmental mammalian model has identified novel genes previously not implicated in acrylamide neurotoxicity that can be further developed into biomarkers for assessing the risk of acrylamide exposure. Three-week-old male Wistar rat pups were treated with either acrylamide or saline daily (30 mg/kg) for 21 days, then tissues (cerebellum, spinal cord, and sciatic nerve) were harvested and frozen. Two biological replicate samples, each sample consisting of pooled tissue from 2 rats, were analyzed for each treatment.
2012-02-08 | E-GEOD-29004 | biostudies-arrayexpress
Project description:microRNA profiling of rat small intestinal crypt cell IEC-6. Comparing control untreated with cells treated with transforming growth factor-beta (TGF-beta). TGF-beta stimulated cell differentiation, as observed in the stimulation of intestinal epithelial cell markers (alkaline phophotase, villin, aminopeptidase N, etc.).
2012-06-19 | GSE20982 | GEO
Project description:Polycomb-group proteins form multimeric protein complexes involved in transcriptional silencing. The Polycomb Repressive complex 2 (PRC2) contains the Suppressor of Zeste-12 protein (Suz12) and the histone methyltransferase Enhancer of Zeste protein-2 (Ezh2). This complex, catalyzing the di- and tri-methylation of histone H3 lysine 27, is essential for embryonic development and stem cell renewal. However, the role of Polycomb-group protein complexes in the control of the intestinal epithelial cell (IEC) phenotype is not known. We investigated the impact of Suz 12 depletion on gene expression in IEC-6 cells. Multiple shRNA lentiviral constructs were tested in IEC-6 cells for their ability to down-regulate Suz12 expression (MISSION shRNA lentiviral transduction particles, SigmaM-bM-^@M-^SAldrich Canada, Oakville, ON). Forty percent confluent cells were infected in medium supplemented with 4 mg/ml polybrene (SigmaM-bM-^@M-^SAldrich Canada) for 6 h. Two days after infection, cell populations were selected with 2 mg/ml puromycin (SigmaM-bM-^@M-^SAldrich Canada). The clone TRCN0000038728 was selected: the shRNA against Suz12 (GCTGACAATCAAATGAATCAT) is conserved in rat (accession number FM084383), murine (accession number NM_199196) and human (accession number NM_015355.2) Suz12 sequences. Efficiency of infection was estimated at 25%. Control or ShSuz12 IEC-6 cell total RNAs were isolated with the Rneasy kit (Qiagen, Mississauga, ON, Canada), according to the manufacturerM-bM-^@M-^Ys instructions. RNA samples from three independent experiments were used for microarray analysis.
2014-08-02 | E-GEOD-60003 | biostudies-arrayexpress
Project description:Acrylamide is a reproductive toxicant that has been detected in foods such as potato chips and breads. The consequences of chronic exposure to acrylamide in the human diet are unknown; however we previously reported that exposure to acrylamide at levels equivalent to human exposure produced high levels of genetic damage in early male germ cells of mice [Nixon et al. ToxSci 129(1), 135–145 (2012)]. In the present study, we examined changes in testicular gene expression in these mice to examine the potential mechanisms involved in acrylamide induced DNA damage in male germ cells and to provide a better understanding of the reproductive toxic effects of acrylamide in the male. Adult male mice were subjected to chronic acrylamide exposure via the drinking water at concentrations of 0, 0.001, 0.01, 0.1, 1 and 10 µg/ml for 1, 6 and 12 months. The testes were collected at each time point for RNA extraction and hybridization on an Illumina Sentrix Mouse ref-8 v2 Beadchip.
2014-06-01 | E-GEOD-47574 | biostudies-arrayexpress
Project description:microRNA profiling of rat small intestinal crypt cell IEC-6. Comparing control untreated with cells treated with transforming growth factor-beta (TGF-beta). TGF-beta stimulated cell differentiation, as observed in the stimulation of intestinal epithelial cell markers (alkaline phophotase, villin, aminopeptidase N, etc.). Two condition experiment. Control vs TGF-beta treatment. Biological replicates: 3 control, 3 treated. Independently grown and harvested. One replicate per array
2012-06-18 | E-GEOD-20982 | biostudies-arrayexpress
Project description:In this study, we established a rat small intestinal cell (IEC-6) injury model with tumor necrosis factor-α (TNF-α). Then, we added the exosomes from TNF- α damaged IEC-6 (TNF-α-exo), co-cultured with BMMSCs exosomes (BM-exo) and heme oxygenase-1 modified BMMSCs (HBM-exo) system exosomes into IEC-6 cells injured by TNF- α inflammation. After 48 hours, IEC-6 cells were collected for proteomic detection.
2020-06-29 | PXD017002 | Pride
Project description:Acrylamide, a high-production-volume chemical and food contaminant in baked and fried carbohydrate-rich foods has been classified as a “Group 2A carcinogen” (probable human carcinogen) by the IARC. The carcinogenicity of acrylamide is attributed to its well-recognized genotoxicity; however, evidence suggests that acrylamide may also induce non-genotoxic alterations. In the present study female B6C3F1 mice were exposed to 0.70mM acrylamide in drinking water for 28 days and genotoxic and transcriptomic effects were investigated in the lung, a target organ for acrylamide carcinogenicity in mice, and the liver, a non-target organ. Acrylamide exposure resulted in a dose-dependent formation of N7-(2-carbamoyl-2-hydroxyethyl)guanine and N3-(2-carbamoyl-2-hydroxyethyl)adenine in lung and liver DNA at the similar levels. In contrast, whole genome gene expression profiles in the lungs and livers revealed the tissue-specific gene expression alterations. By using a SurePrint G3 Mouse Gene Expression v2 8x60K Microarray Kit (Agilent Technologies), we identified 123 and 363 genes that were found to be differentially expressed in the lungs and livers of acrylamide-treated mice; however, only 5 genes were in common between the organs. A detailed analysis of differentially expressed genes revealed that the major difference in the effect of acrylamide on the transcriptome in the lungs and livers was related to a different trend of gene expression changes. In the lungs, acrylamide exposure caused an inhibition of gene expression (54 up-regulated and 69 down-regulated genes), whereas the opposite effect, characterized by twice the number of up-regulated as compare to down-regulated genes (245 up-regulated and 118 down-regulated), was found in the livers of exposed mice.
2019-01-30 | GSE125851 | GEO
Project description:FADD-IEC KO and CASP8 IEC-KO mice spontaneously develop chronic ileitis charcterized by inflammatory gene expression. We characterized the role of MLKL, RIPK3, ZBP1, in the upregulation of inlflammatory genes in these mice. We used microarray to study the effect of MLKL, RIPK3 and ZBP1 on the gene expression profile in FADD IEC-KO and/or CASP8 IEC-KO mice and detect effects on specific inflammatory genes.
2020-05-01 | GSE137280 | GEO