Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Cut&tag of H3K4me3 for KDM5A-knockout 293T cell and control 293T.

ABSTRACT: KDM5A-KO HEK293T cells were purchased from Beyotime (Shanghai, China). These KDM5A-KO HEK293T cells are polyclonal cells infected with lentivirus expressing the single guide RNA (sgRNA) and Cas9 and containing a puromycin resistance cassette and were characterized via a T7EI assay. The sgRNA sequence used to generate the KDM5A-KO cells was TCTCCGCCAAAGGCCGGATG. The sequences of the PCR primers specific for KDM5A were as follows: forwards, 5’CTTCAGCCAGCTTTTCTCCA3’; and reverse, 5’TCAGTTCCCAAGTTCTAGGC3’. H3k4me3(CST) cut&tag was performed for further analysis.

ORGANISM(S): Homo sapiens

PROVIDER: GSE299191 | GEO | 2025/12/09

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Genome-wide maps of KDM5A/JARID1A/RBP2 in mouse ES cells.

Project description:We report the identification of genomic regions bound by KDM5A in mouse embryonic stem (ES) cells and define the functional categories that these regions represent. KDM5A modifies methylated lysine residues on histone tails. We developed anti-KDM5A antibodies and set to detect genomic regions enriched with these antibodies using cells with normal Kdm5a or cells from Kdm5a knockout mice as a control. We found high enrichment with the KDM5A antibodies in normal cells when compared with the genomic background. We found striking identity in the regions enriched with these antibodies in normal cells when compared with the total genomic DNA or with KDM5A ChIP assays from Kdm5a KO cells, showing that the antibodies are specific. Examination of target genes in ES cells

2012-10-04 | E-GEOD-28343 | biostudies-arrayexpress

RNA-sequencing after CRISPR knockout of KDM5A in the GLC16 small cell lung cancer cell line

Project description:We report the RNA-sequencing results after CRISPR inactivation of KDM5A compared to a non-targeting sgRNA 14 days after lentiviral infection of GLC16 cells

2020-11-16 | GSE161513 | GEO

Genome-wide maps of KDM5A/JARID1A/RBP2 in mouse ES cells.

2012-10-04 | GSE28343 | GEO

Gene expression profiles of KDM5A-/- MEFs with wild-type KDM5A or KDM5A-H483A mutant

Project description:Gene expression profiles of Immortalized KDM5A-/- MEFs with re-introduction of wild-type KDM5A or KDM5A-H483A mutant.

2017-02-08 | GSE84309 | GEO

Genome-wide KDM5A occupancy after MK2206/DMSO treatment of T47D cells

Project description:We perfomed ChIP-seq using KDM5A antibodies in T47D cells after 24 hour treatment with the AKT inhibitor MK2206 or DMSO. We show that the cistrome of the H3K4 demethylase KDM5A is affected by AKT inhibition. Comparison of genome-wide KDM5A binding after AKT inhibition vs vehicle

2016-06-14 | E-GEOD-80593 | biostudies-arrayexpress

Myogeneic differentiation in Rb1 or Kdm5a/Jarid1a/Rbp2 deficient mouse embryonic fibroblasts.

Project description:Cells lacking Rb1 are deficient in differentiation. Loss of Kdm5a rescues myogenic differentiation, as judged by appearance of morphologically normal myotubes that display expression of late markers of differentiation. In order to better understand how Kdm5a loss rescues differentiation, we induced mouse embryonic fibroblasts (MEFs) of different genotypes to undergo myogenic differentiation and analyzed gene expression changes in wild-type, Kdm5a-/-, Rb1-/- and Kdm5a-/-; Rb1-/- cells. Rb1-/- cells stained single nucleated, did not exhibit morphological changes and increased expression of the myogenic marker MYHC. Except for Rb1-/- cells, all other cells were undergoing successful convertion into aligned multinucleated myotubes and were MYHC-positive. We obtained purified populations of myotubes for the wild-type and Kdm5a-/-; Rb1-/- cells. RNA-seq analysis of gene expression in Rb1 or Kdm5a deficient MEFs that were induced for myogenic differentiation.

2015-08-12 | E-GEOD-53528 | biostudies-arrayexpress

Cut&tag of H3K4me3 for KDM5A-knockout 293T cell and control 293T.

Project description:Cut&tag of H3K4me3 for KDM5A-knockout 293T cell and control 293T.

| PRJNA1273051 | ENA

Whole genome inducible CRISPR KO screens for HIFa activity

Project description:Hypoxic inducible factors control the cellular response low oxygen by transcription regulation of gene programs. In order to understand the genes that control HIFa transcription factor regulated gene expression we generated dual fluorescent dFLASH-HIF reporter cells lines in HEK293T and U2OS cells to monitor HIFa activity. We then generated dox-inducible Cas9-TagBFP expressing reporter lines and performed 3 replicate genome wide KO gain- or loss- of function screens for HIF activity in U2OS and HEK293T reporter cell lines using the Brunello sgRNA KO library (~79,000 sgRNA, covering ~19,000 genes). High throughput sequencing was used to identify sgRNAs in enriched vs library samples and sgRNA enrichment quantified by either DEseq2 or MAGeck.

2025-03-21 | GSE290538 | GEO

KDM5A regulates p53 function

Project description:KDM5A regulates p53 expression by modulating the expression of a subgroup of translation iniation genes.

2018-11-14 | GSE107221 | GEO

KDM5A regulates p53 function

Project description:KDM5A regulates p53 function

| PRJNA419354 | ENA