Genomics

Dataset Information

0

Cut&tag of H3K4me3 for KDM5A-knockout 293T cell and control 293T.


ABSTRACT: KDM5A-KO HEK293T cells were purchased from Beyotime (Shanghai, China). These KDM5A-KO HEK293T cells are polyclonal cells infected with lentivirus expressing the single guide RNA (sgRNA) and Cas9 and containing a puromycin resistance cassette and were characterized via a T7EI assay. The sgRNA sequence used to generate the KDM5A-KO cells was TCTCCGCCAAAGGCCGGATG. The sequences of the PCR primers specific for KDM5A were as follows: forwards, 5’CTTCAGCCAGCTTTTCTCCA3’; and reverse, 5’TCAGTTCCCAAGTTCTAGGC3’. H3k4me3(CST) cut&tag was performed for further analysis.

ORGANISM(S): Homo sapiens

PROVIDER: GSE299191 | GEO | 2025/12/09

REPOSITORIES: GEO

Dataset's files

Source:
Action DRS
Other
Items per page:
1 - 1 of 1

Similar Datasets

2012-10-04 | E-GEOD-28343 | biostudies-arrayexpress
2020-11-16 | GSE161513 | GEO
2012-10-04 | GSE28343 | GEO
2017-02-08 | GSE84309 | GEO
2016-06-14 | E-GEOD-80593 | biostudies-arrayexpress
| PRJNA1273051 | ENA
2015-08-12 | E-GEOD-53528 | biostudies-arrayexpress
2025-03-21 | GSE290538 | GEO
2018-11-14 | GSE107221 | GEO
| PRJNA419354 | ENA