Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Expression profiling by high throughput sequencing of Myosin VI

ABSTRACT: Around 75% of breast cancer patients have estrogen receptor (ER) positive breast cancer. Endocrine-related therapies employed to treat these patients often fail due to resistance. Consequently, new therapeutic targets are needed. Myosin VI (MVI) is increasingly implicated in cancer and has been identified to interact with the ER, and it has roles in the spatial organisation of RNA Polymerase II. In addition, gene and protein expression levels of ER and MVI are correlated across breast cancer tissue samples.

ORGANISM(S): Homo sapiens

PROVIDER: GSE300165 | GEO | 2026/01/13

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Single molecule nanoscopy reveals that nuclear myosin VI regulates the spatial organization of mammalian transcription initiation

Project description:During transcription, RNA Polymerase II (RNAPII) is spatially organised into clusters that correlate with transcription activity. However, the assembly, organisation and stability of these transcription units remains unknown. Here, we have combined single molecule imaging with genomics approaches in order to explore the role of nuclear myosin VI in the nanoscale organisation of RNAPII. We can reveal that myosin VI acts as the molecular anchor that holds RNAPII into these transcription factories. Perturbation of myosin VI leads to the disruption of RNAPII localisation, changes in chromatin organisation and subsequently a decrease in gene expression. This role of Myosin VI is particularly important for transcription events following stimulation, where multiple genes are simultaneously activated.

2020-05-31 | GSE149448 | GEO

Nuclear myosin VI maintains replication fork stability

Project description:The actin cytoskeleton is of fundamental importance for cellular structure and plasticity. However, abundance and function of filamentous (F-) actin in the nucleus are still controversial. Here we show that the actin-based molecular motor myosin VI contributes to the stabilization of stalled or reversed replication forks. In response to DNA replication stress, myosin VI associates with stalled replication intermediates and cooperates with the AAA ATPase WRNIP1 in protecting these structures from DNA2-mediated nucleolytic attack. Using functionalized DARPins to manipulate myosin VI levels in a compartment-specific manner, we provide evidence for the direct involvement of myosin VI in the nucleus and against a contribution of the abundant cytoplasmic pool during the replication stress response.

2023-05-04 | PXD035394 | Pride

Study of endogenous interactome of Myosin VI

Project description:Immunoprecipitation of endogenous Myosin VI in Human Cell Lines (Caco-2, HeLa, MCF10A, MDA-MB-231) and identification of true interactors by mass spectrometry

2021-07-08 | PXD026697 | Pride

Expression profiling by high throughput sequencing of Myosin VI

Project description:Expression profiling by high throughput sequencing of Myosin VI

| PRJNA1279160 | ENA

Transcriptomic Profiling of Myosin 1e WT and KO 4T1 Cell Pools

Project description:Myosin 1e may influnece the metastatic spread of breast cancer cells as determined using the MMT-PyMT mouse model deficient in myo1e, which demonstrated no lung metastases. Therefore, we used CRISPR to knock out Myosin 1e (myo1e) in the 4T1 breast cancer line to study the effect on the propensity to metastasize. The Myosin 1e (Myo1e) WT and KO 4T1 cell pools were generated by Synthego using gRNA sequence 'CUUCUUCAGGUUCUCUACAA'.

2023-12-18 | GSE202685 | GEO

How Myosin VI Traps its Off-State, is Activated and Dimerizes

Project description:Myosin VI (Myo6) is the only minus-end directed nanomotor on actin, allowing it to uniquely contribute to numerous cellular functions. As for other nanomotors, proper functioning of Myo6 relies on precise spatio-temporal control of motor activity via a poorly defined off-state and interactions with partners. Our structural, functional, and cellular studies reveal key features of myosin regulation and indicate that not all partners can activate Myo6. TOM1 and Dab2 cannot bind the off-state while, GIPC1 binds Myo6, releases its auto-inhibition and triggers proximal dimerization. Myo6 partners thus differentially recruit Myo6. We solved a crystal structure of the proximal dimerization domain, and show that its disruption compromises endocytosis in HeLa cells, emphasizing the importance of Myo6 dimerization. Finally, we show that the L926Q deafness mutation disrupts Myo6 auto-inhibition and indirectly impairs proximal dimerization. Our study thus demonstrates the importance of partners in the control of Myo6 auto-inhibition, localization, and activation.

2024-01-26 | PXD044767 | Pride

Single molecule nanoscopy reveals that nuclear myosin VI regulates the spatial organization of mammalian transcription initiation

Project description:Single molecule nanoscopy reveals that nuclear myosin VI regulates the spatial organization of mammalian transcription initiation

| PRJNA628703 | ENA

Ribonucleoprotein immunoprecipitation of myosin proteins and myosin-specific chaperones in fission yeast

Project description:Ribonucleoprotein immunoprecipitation microarray (RIp-chip) study using various myosin proteins and myosin-specific chaperones from the fission Schizosaccaromyces pombe

2010-03-01 | E-TABM-335 | biostudies-arrayexpress

Myo6 regulate transcriptional pause release

Project description:Global run-on sequencing analyses of murine T cells with or without Myosin VI were performed to determine the effect of anti-CD3 stimulation and loss of Myosin VI on the transcription elongation

2015-01-28 | E-MTAB-2381 | biostudies-arrayexpress

RNA-seq of breast cancer cell lines post ligand treatment II

Project description:Goal: study the impact of estrogen receptor ligands on gene expression in HR+ breast cancer cells Methods: RNA sequencing Results: Ligand 4-OH tamoxifen, a selective ER modulator (SERM), promotes transcriptional activation of ER and mimics the transcriptional effect of natural ligand E2 for a subset of ER target genes, consistently across the seven breast cell lines (MDA-MB-134 VI, MDA-MB-330, EFM-19, T-47D, and BT-474). Selective ER degraders (SERD) fulvestrant and GDC-0927 on the other hand do not induce, or induce very weakly the expression of ER target genes. The effect of GDC-0810 depends on the cellular context.

2019-07-25 | GSE128911 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data