Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Stag2-cohesin play dominant roles in regulating antibody class switch recombination [3C-HTGTS]

ABSTRACT: Class switch recombination (CSR) in B lymphocytes generates different functional antibody isotypes and cohesin-mediated chromatin loop extrusion is proposed to promote CSR. However, the detailed regulatory mechanism of cohesin in CSR is largely lacking. Here, we revealed that Stag2 is a specific cohesin regulator playing critical roles in promoting CSR. Stag2-deficiency, not Stag1-deficiency, significantly decreases the interaction of acceptor CH with CSR center, leading to decreased transcription of acceptor CH and impaired CSR. Notably, Stag2 could compensate for Stag1 binding within Igh upon Stag1-deficiency, while Stag2-deficiency significantly decreases Stag1 binding within Igh. Interestingly, Stag2 expression is higher than Stag1 during germinal center (GC) B cell development and Stag2 expression has a high correlation with CSR level in GC B cells upon vaccination and SARS-Cov-2 infection. Furthermore, Stag2 is also highly expressed in GC B cells within different tumors, corresponding to the high level of CSR in tumors. Altogether, our findings uncover the unrecognized specific roles of Stag2 in regulating CSR during physiological and pathological immune responses.

ORGANISM(S): Mus musculus

PROVIDER: GSE312226 | GEO | 2026/05/20

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Stag2-cohesin play dominant roles in regulating antibody class switch recombination [RNA-Seq]

Project description:Class switch recombination (CSR) in B lymphocytes generates different functional antibody isotypes and cohesin-mediated chromatin loop extrusion is proposed to promote CSR. However, the detailed regulatory mechanism of cohesin in CSR is largely lacking. Here, we revealed that Stag2 is a specific cohesin regulator playing critical roles in promoting CSR. Stag2-deficiency, not Stag1-deficiency, significantly decreases the interaction of acceptor CH with CSR center, leading to decreased transcription of acceptor CH and impaired CSR. Notably, Stag2 could compensate for Stag1 binding within Igh upon Stag1-deficiency, while Stag2-deficiency significantly decreases Stag1 binding within Igh. Interestingly, Stag2 expression is higher than Stag1 during germinal center (GC) B cell development and Stag2 expression has a high correlation with CSR level in GC B cells upon vaccination and SARS-Cov-2 infection. Furthermore, Stag2 is also highly expressed in GC B cells within different tumors, corresponding to the high level of CSR in tumors. Altogether, our findings uncover the unrecognized specific roles of Stag2 in regulating CSR during physiological and pathological immune responses.

2026-05-20 | GSE312230 | GEO

Stag2-cohesin play dominant roles in regulating antibody class switch recombination [CSR-HTGTS-Seq]

2026-05-20 | GSE312227 | GEO

Stag2-cohesin play dominant roles in regulating antibody class switch recombination [PRO-Seq]

2026-05-20 | GSE312229 | GEO

Stag2-cohesin play dominant roles in regulating antibody class switch recombination [ChIP-Seq]

2026-05-20 | GSE312228 | GEO

The Chromatin Reader ZMYND8 Regulates Igh Enhancers to Promote Immunoglobulin Class Switch Recombination

Project description:Class Switch Recombination (CSR) is a DNA recombination reaction that diversifies the effector component of antibody responses. CSR is initiated by activation-induced cytidine deaminase (AID), which targets transcriptionally active immunoglobulin heavy chain (Igh) switch donor and acceptor DNA. The 3’ Igh super-enhancer, 3’ Regulatory Region (3’RR), is essential for acceptor region transcription, but how this function is regulated is unknown. Here we identify the chromatin reader ZMYND8 as an essential regulator of the 3’RR and CSR. In B cells, ZMYND8 binds promoters and super-enhancers, including the 3’RR, and controls its activity by modulating the enhancer transcriptional status. In its absence, there is increased 3’RR polymerase loading, and decreased acceptor region transcription and CSR. In addition to CSR, ZMYND8 deficiency impairs somatic hypermutation (SHM) of Igh, which is also dependent on the 3’RR. Thus ZMYND8 controls Igh diversification in mature B lymphocytes by regulating the activity of the 3’ Igh super-enhancer.

2018-10-04 | GSE118794 | GEO

Med1 facilitates transcriptional activation and dynamic long-range contacts at the IgH locus during class switch recombination.

Project description:Immunoglobulin class switch recombination (CSR) is initiated by the transcription-coupled recruitment of activation induced cytidine deaminase (AID) to immunoglobulin switch (S) regions. During CSR, the IgH locus undergoes dynamic three-dimensional structural changes in which promoters, enhancers and S regions are brought to close proximity. Nevertheless, little is known about the underlying mechanisms. Here we conditionally inactivated in B cells the Med1 subunit of mediator, a complex implicated in transcription initiation and long-range enhancer/promoter loop formation. We find that Med1-deficiency results in defective CSR, reduced acceptor switch region transcription and that this correlates with reduced long-range interactions between the acceptor switch regions and the Em enhancer, as determined by 4C-Seq. Our results implicate the mediator complex in the mechanism of CSR and are consistent with a model in which Med1 facilitates the transcriptional activation of switch regions and their long-range contacts with the IgH locus enhancers during CSR. 4C-seq data in resting and activated WT and Med1 mutant B cells. 4C bait was designed in the Eu enhancer of the Igh locus on chromosome 12. Primer sequences: 5â TCTGTCCTAAAGGCTCTGAGA 3â and 5â GAACACAGAAGTATGTGTATGGA 3â.

2016-02-17 | E-GEOD-62969 | biostudies-arrayexpress

Chromatin-intrinsic mechanisms determine orientation-specific class switch recombination [PRO-seq]

Project description:Activation-induced cytidine deaminase (AID)-initiated immunoglobulin heavy chain (Igh) class switch recombination (CSR) replaces donor Cμ constant region exons (CHs) with a downstream acceptor CH to generate different functional antibody isotypes. However, mechanisms governing orientation-specific productive CSR remain incompletely understood. Through analysing the characteristics of evolved constant regions and constructing diversified constant regions to recapitulate productive CSR in jawed vertebrates to systematically dissect productive CSR determinants, we found that switch topological configuration (STC), including transcriptional orientation, chromatin distance, and chromatin domain of Igh, determines orientation-specific joining of AID-initiated breaks for productive CSR. Long-distance CHs under co-oriented transcription within Igh domain foster predominantly deletional joining-mediated productive CSR. In contrast, oppositely transcribed and short-distance CHs affect end-joining bias via promoting diffusion-mediated inversional joining for CSR with lower efficiency. Moreover, AID-initiated breaks in different domains, facilitate more diffusion-mediated orientation-unbiased end-joining for non-productive CSR. Our findings uncover chromatin-intrinsic mechanisms safeguarding orientation-specific productive CSR throughout evolution.

2026-03-14 | GSE299975 | GEO

Chromatin-intrinsic mechanisms determine orientation-specific class switch recombination [3C-HTGTS]

2026-03-14 | GSE299499 | GEO

Chromatin-intrinsic mechanisms determine orientation-specific class switch recombination [CSR-HTGTS-Seq]

2026-03-14 | GSE299392 | GEO

Chromatin-intrinsic mechanisms determine orientation-specific class switch recombination [ChIP-Seq]

2026-03-14 | GSE299391 | GEO