Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

PARN-Driven Alternative Polyadenylation Regulates Immunoglobulin Homeostasis in Antibody-Secreting Cells [CLIP-seq]

ABSTRACT: Class switch recombination (CSR) is a programmed DNA recombination process that enables B cells to switch the isotype of antibodies they produce, thereby generating high-affinity immunoglobulins essential for adaptive immunity. Of note, systemic lupus erythematosus (SLE) frequently arises in the context of hypersensitivity; however, the precise mechanisms underlying its pathogenesis remain incompletely understood. Here, we demonstrate that poly(A)-specific ribonuclease (PARN), an RNA-binding protein, acts as a critical regulator of CSR. In antibody-secreting cells, loss of PARN impairs CSR, resulting in a reduced proportion of cells producing post-switched immunoglobulin isotypes. Mechanistically, PARN specifically binds to the enhancer motif UGUA and the polyadenylation signal AAUAAA. PARN subsequently promotes transcript 3’ UTR shortening through alternative polyadenylation to regulate RNA stability. Depletion of PARN contributes to widespread 3’ UTR lengthening across the transcriptome, significantly affecting the Foxp1 transcript, and consequently impedes CSR efficiency. We further identified PTBP1 and PABP1 as cofactors that functionally cooperate with PARN to suppress CSR. Analysis of human datasets further reveals that Parn expression is elevated in patients with SLE. In an SLE mouse model, targeted Parn knockout in B lymphocytes undergoing CSR alleviates disease severity. This study unveils PARN as a key modulator of CSR in B cells, highlighting its therapeutic potential in SLE.

ORGANISM(S): Mus musculus

PROVIDER: GSE313463 | GEO | 2026/07/15

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

PARN-Driven Alternative Polyadenylation Regulates Immunoglobulin Homeostasis in Antibody-Secreting Cells [PARN ISO-seq]

Project description:Class switch recombination (CSR) is a programmed DNA recombination process that enables B cells to switch the isotype of antibodies they produce, thereby generating high-affinity immunoglobulins essential for adaptive immunity. Of note, systemic lupus erythematosus (SLE) frequently arises in the context of hypersensitivity; however, the precise mechanisms underlying its pathogenesis remain incompletely understood. Here, we demonstrate that poly(A)-specific ribonuclease (PARN), an RNA-binding protein, acts as a critical regulator of CSR. In antibody-secreting cells, loss of PARN impairs CSR, resulting in a reduced proportion of cells producing post-switched immunoglobulin isotypes. Mechanistically, PARN specifically binds to the enhancer motif UGUA and the polyadenylation signal AAUAAA. PARN subsequently promotes transcript 3’ UTR shortening through alternative polyadenylation to regulate RNA stability. Depletion of PARN contributes to widespread 3’ UTR lengthening across the transcriptome, significantly affecting the Foxp1 transcript, and consequently impedes CSR efficiency. We further identified PTBP1 and PABP1 as cofactors that functionally cooperate with PARN to suppress CSR. Analysis of human datasets further reveals that Parn expression is elevated in patients with SLE. In an SLE mouse model, targeted Parn knockout in B lymphocytes undergoing CSR alleviates disease severity. This study unveils PARN as a key modulator of CSR in B cells, highlighting its therapeutic potential in SLE.

2026-07-15 | GSE313542 | GEO

PARN-Driven Alternative Polyadenylation Regulates Immunoglobulin Homeostasis in Antibody-Secreting Cells [2P-seq]

2026-07-15 | GSE313461 | GEO

PARN-Driven Alternative Polyadenylation Regulates Immunoglobulin Homeostasis in Antibody-Secreting Cells [CRIC-seq]

2026-07-15 | GSE313464 | GEO

PARN-Driven Alternative Polyadenylation Regulates Immunoglobulin Homeostasis in Antibody-Secreting Cells

Project description:Class switch recombination (CSR) is a programmed DNA recombination process that enables B cells to switch the isotype of antibodies they produce, thereby generating high-affinity immunoglobulins essential for adaptive immunity. Notably, systemic lupus erythematosus (SLE) frequently arises in the context of hypersensitivity; however, the precise mechanisms underlying its pathogenesis remain incompletely understood. Here, we demonstrate that poly(A)-specific ribonuclease (PARN), an RNA-binding protein, acts as a critical regulator of CSR. In antibody-secreting cells, loss of PARN impairs CSR, resulting in a reduced proportion of cells producing post-switched immunoglobulin isotypes. Mechanistically, PARN specifically binds to the enhancer motif UGUA and the polyadenylation signal AAUAAA. PARN subsequently promotes transcript 3’ UTR shortening through alternative polyadenylation to regulate RNA stability. Depletion of PARN contributes to widespread 3’ UTR lengthening across the transcriptome, notably affecting the Foxp1 transcript, and consequently impedes CSR efficiency. We further identified PTBP1 and PABP as cofactors that functionally cooperate with PARN to suppress CSR. Analysis of human datasets further reveals that Parn expression is elevated in patients with SLE. In an SLE mouse model, targeted Parn knockout in B lymphocytes undergoing CSR alleviates disease severity. This study unveils PARN as a key modulator of CSR in B cells, highlighting its therapeutic potential in SLE.

2026-07-15 | GSE312680 | GEO

Reconstitution of CPSF active in polyadenylation: Recognition of the polyadenylation signal by WDR33

Project description:Cleavage and polyadenylation specificity factor (CPSF) is the central component of the 3' processing machinery for polyadenylated mRNAs in metazoans: CPSF recognizes the polyadenylation signal AAUAAA, providing sequence specificity in both pre-mRNA cleavage and polyadenylation, and catalyzes pre-mRNA cleavage. Here we show that of the seven polypeptides that have been proposed to constitute CPSF, only four, CPSF160, CPSF30, hFip1 and WDR33, are necessary and sufficient to reconstitute a CPSF subcomplex active in AAUAAA-dependent polyadenylation, whereas CPSF100, CPSF73 and symplekin are dispensable. WDR33 is required for binding of reconstituted CPSF to AAUAAA-containing RNA and can be specifically UV-crosslinked to such RNAs, as can be CPSF30. Transcriptome-wide identification of WDR33 targets by PAR-CLIP shows that WDR33 specifically binds the AAUAAA signal in vivo in contrast to any of the five other CPSF subunits tested before. Thus, our data indicate that the CPSF subunit that is mainly responsible for recognizing the polyadenylation signal is WDR33 and not CPSF160, as suggested by previous studies. Transcriptome-wide profiling of WDR33 binding sites using PAR-CLIP in HEK293 cells.

2014-09-25 | E-GEOD-61123 | biostudies-arrayexpress

Acetylated Histone Reader Brd4 functions as Repair Adaptor in Immunoglobulin Class Switch Recombination

Project description:Class Switch Recombination (CSR) is a B cell specific genomic alteration induced by activation induced cytidine deaminase (AID)-dependent DNA break, followed by repair and recombination at the immunoglobulin heavy-chain locus. The involvement of several chromatin-associated factors in promoting AID-induced DNA break formation has been reported. However, the involvement of chromatin adaptors at the repair phase of CSR remains unknown. Here, we provide evidence that acetylated histone reader Brd4 is critical to the repair and recombination step of CSR. Brd4 was recruited to the AID-induced DNA break region, and depletion of Brd4 from the S region chromatin by knockdown or a chemical inhibitor JQ1 causes CSR impairment without affecting AID-induced DNA break generation. Such inhibition of Brd4 suppressed the accumulation of 53BP1 and UNG at the cleaved S regions, perturbed switch donor-switch acceptor microhomology length and reduced Igh/c-myc translocation. We conclude that Brd4 serves as a histone-reader platform required for the recruitment of CSR repair components.

2014-06-20 | GSE52239 | GEO

Acetylated Histone Reader Brd4 functions as Repair Adaptor in Immunoglobulin Class Switch Recombination

2014-06-20 | E-GEOD-52239 | biostudies-arrayexpress

Reconstitution of CPSF active in polyadenylation: Recognition of the polyadenylation signal by WDR33

2014-09-25 | GSE61123 | GEO

A damage independent role for 53BP1 that impacts break order and Igh architecture during CSR

Project description:During Class Switch Recombination (CSR) B cells replace the Igh CÎ¼/Î´ exons with another downstream constant region exon (CH), altering the antibody isotype. CSR occurs through the introduction of AID-mediated double strand break (DSBs) in switch regions and subsequent ligation of broken ends. Here we developed an assay to investigate the dynamics of DSB introduction in individual cells. We demonstrate that the upstream switch region SÎ¼ is always targeted first during recombination and that the mechanism underlying this control relies on 53BP1. Surprisingly, regulation of break order occurs through residual binding of 53BP1 to chromatin before the introduction of damage and independent of its established role in DNA repair. Using chromosome conformation capture we show that 53BP1 mediates changes in chromatin architecture that affect break order. Finally, our results explain how changes in Igh architecture in the absence of 53BP1 could promote inversional rearrangements that compromise CSR. High Resolution 4C was performed in resting and activated B cells using a bait on the EÎ¼ enhancer

2016-06-16 | E-GEOD-81180 | biostudies-arrayexpress

Med1 facilitates transcriptional activation and dynamic long-range contacts at the IgH locus during class switch recombination.

Project description:Immunoglobulin class switch recombination (CSR) is initiated by the transcription-coupled recruitment of activation induced cytidine deaminase (AID) to immunoglobulin switch (S) regions. During CSR, the IgH locus undergoes dynamic three-dimensional structural changes in which promoters, enhancers and S regions are brought to close proximity. Nevertheless, little is known about the underlying mechanisms. Here we conditionally inactivated in B cells the Med1 subunit of mediator, a complex implicated in transcription initiation and long-range enhancer/promoter loop formation. We find that Med1-deficiency results in defective CSR, reduced acceptor switch region transcription and that this correlates with reduced long-range interactions between the acceptor switch regions and the Em enhancer, as determined by 4C-Seq. Our results implicate the mediator complex in the mechanism of CSR and are consistent with a model in which Med1 facilitates the transcriptional activation of switch regions and their long-range contacts with the IgH locus enhancers during CSR. 4C-seq data in resting and activated WT and Med1 mutant B cells. 4C bait was designed in the Eu enhancer of the Igh locus on chromosome 12. Primer sequences: 5â TCTGTCCTAAAGGCTCTGAGA 3â and 5â GAACACAGAAGTATGTGTATGGA 3â.

2016-02-17 | E-GEOD-62969 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data