Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

High throughput sequencing data of equol aptamers obtained through Capture-SELEX after 15 rounds of selection

ABSTRACT: Expanding healthy life expectancy requires technologies for continuous and non-invasive health monitoring. Sensors detecting health-related biomarkers in urine can be used for such applications. DNA aptamers targeting equol, a gut microbiota–derived metabolite with various health benefits, were obtained by Capture-SELEX to construct the aptamer-based equol sensors.

ORGANISM(S): synthetic construct

PROVIDER: GSE314478 | GEO | 2026/08/06

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

ssDNA aptamers targeting Salmonella paratyphi A [SELEX]

Project description:Here, we report an ssDNA aptamer with high specificity and affinity towards Salmonella paratyphi A generated using the whole-cell SELEX process. The aptamers generated against an organism show salient features, such as higher affinity than existing antibodies, and are highly specific towards the targeted organism. Thus, the generated aptamer sequences can serve as potential biomarkers for the onsite detection of pathogens with high specificity and sensitivity. Molecular dynamics simulation was used to model the linear chain of the aptamers to a three-dimensional conformation, and the binding mechanism against DNA gyrase was established.

2019-12-31 | GSE137006 | GEO

ssDNA aptamers against amyloid-β peptide as biomarker and inhibtor [SELEX]

Project description:We report high-affinity ssDNA aptamers as biomarkers and antagonists of amyloid-β peptide. We generated three novel aptamer sequences from the pool of aptamers through the SELEX process, and evaluated their affinity and sensitivity using enzyme-linked immunosorbent assay (ELISA). (The forward primer: ATTAGTCAAGAGGTAGACGCACATA, reverse primer TTCTGGTCGTCGTGACTCCTAT) The ssDNA aptamers modeled into a three-dimensional structure; interaction and mechanism of action derived through molecular dynamics simulations (MD). MD simulations revealed the nature of binding and inhibition of aggregation by binding with amyloid-β peptide monomers, dimers, and other oligomers. The presence of high non-bonded interaction energy along with hydrogen bonds constitutes the complex structure of the aptamer-amyloid-β peptide. Furthermore, the changes in the secondary structure induced by aptamers may help remove the peptide through the blood-brain barrier. This study provided a framework for the application of aptamers against amyloid-β peptides as biomarkers and antagonists.

2019-09-30 | GSE124865 | GEO

Selection of RNA aptamers against human islets by SELEX and toggle SELEX

Project description:Type 1 Diabetes is still an incurable disease characterized by autoimmune destruction of insulin-producing beta cells within the islet of Langerhans in the pancreas. Currently, there are no methods to monitor beta-cell mass in humans or deliver therapeutics specifically to beta cells. Here we performed Cluster Systematic Evolution of Ligands by Exponential Enrichment (SELEX) experiments and toggle SELEX experiments to identify RNA aptamers specific for human islets. In the cluster SELEX, we started from a random library of RNA nucleotides composed of a 40 nucleotide long variable region flanked by two constant regions. We performed eight selection cycles using hand-picked islets and islet-depleted acinar tissue from 4 cadaveric human donors as positive and negative selectors. In the toggle SELEX, we conducted eight cycles of selection using islets and acinar tissue from mice, followed by two cycles of selection using human tissues. The polyclonal libraries from the two selection strategies showed a convergent evolution of ligands and increased specificity for human islets.

2022-02-23 | GSE197262 | GEO

ssDNA aptamers targeting Salmonella paratyphi A [SELEX]

Project description:ssDNA aptamers targeting Salmonella paratyphi A [SELEX]

| PRJNA564266 | ENA

Blocker-SELEX: A Structure-Guided Strategy for Developing Inhibitory Aptamers Disrupting Transcription Factor Interactions

Project description:Despite the well-established significance of transcription factors (TFs) in pathogenesis, their utilization as pharmacological targets has been limited by the inherent challenges mainly associated with modulating their protein-protein and protein-DNA interactions. The lack of defined small-molecule binding pockets and the nuclear localization of TFs makes neither small molecule inhibitors nor neutral antibodies suitable in blocking TF interactions. Aptamers are short oligonucleotides exhibiting high affinity and specificity for a diverse range of targets. The large molecular weights, expansive blocking surfaces and efficient cellular internalization make aptamers as a compelling molecular tool for traditional TF interaction modulators. Here, we report a structure-guided design strategy called Blocker-SELEX for developing inhibitory aptamers (iAptamer) that selectively block TF interactions. Our approach led to the discovery of an iAptamer that cooperatively disrupts SCAF4/SCAF8-RNA Polymerase II (RNAP2) interactions, thus dysregulates RNAP2 dependent gene expression and splicing, leading to the impairing of cell proliferation. This approach was further applied to develop iAptamers efficiently block WDR5-MYC interaction. Together, our study highlights the potential of Blocker-SELEX in developing iAptamers that effectively disrupt TF interactions, and the generated iAptamers hold promising implications as chemical tools in studying biological functions of TF interactions and the potential for nucleic acids drug development.

2024-02-01 | GSE254651 | GEO

Selection of RNA aptamers against human islets by SELEX and toggle SELEX

Project description:Selection of RNA aptamers against human islets by SELEX and toggle SELEX

| PRJNA809588 | ENA

High throughput sequencing data of equol aptamers obtained through Capture-SELEX after 15 rounds of selection

Project description:High throughput sequencing data of equol aptamers obtained through Capture-SELEX after 15 rounds of selection

| PRJNA1391383 | ENA

SELEX selection of aptamers targeting PfLDH

Project description:High-throughput sequencing of SELEX rounds to identify enriched aptamer sequences.

| PRJEB111361 | ENA

Identify aptamers binding human PD-L1 protein by SELEX

Project description:Identify aptamers binding human PD-L1 protein by SELEX

| PRJEB65891 | ENA

RNA aptamers specific for transmembrane p24 trafficking protein 6 and Clusterin for the targeted delivery of imaging reagents and RNA therapeutic to human β cells

Project description:The ability to detect and target β cells in vivo can drastically refine the way diabetes is studied and treated. By an unsupervised Systematic evolution of ligands by exponential enrichment (SELEX) we identified two RNA aptamers that specifically recognize mouse and human β cells in vitro and in vivo. Here we took advantage of commercially available high density protein arrays to identify putative target of the two islet specific aptamers. Briefly, 5' biotynilated RNA aptamer 1-717 and m12-3773 were chemically produced , complexed with Alexafluor 647-streptavidin and used as probe on the HuProt™ v2.0 19K protein array. Putative binders were further confirmed by cold target inhibition assays, silencing experiments, and surface plasmon resonance.

2022-02-21 | GSE162273 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data