Effect of SAND variant in Aire, R249C, on thymus epithelial gene expression.
Ontology highlight
ABSTRACT:
ORGANISM(S): Mus musculus
PROVIDER: GSE317273 | GEO | 2026/01/27
REPOSITORIES: GEO
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| Other | ||||
| GSE317273_gene_count_matrix.csv.gz | Csv |
Items per page: 5 1 - 2 of 2 |
Similar Datasets
Project description:Effect of SAND variant in Aire, R249C, on thymus epithelial gene expression.
| PRJNA1406653 | ENA
Project description:Aire in medullary thymic epithelial cells plays an essential role in the negative selection through expression of broad arrays of tissue-restricted antigens. We asked whether Aire could also activate the expression of tissue-restricted antigens in cortical thymic epithelial cells. We established a semi-knockin strain of NOD-background mice expressing Aire under control of the promoter of β5t, a thymoproteasome expressed exclusively in the cortex. We extracted RNA from cortical thymic epithelial cells ectopically expressing Aire and hybridization was performed on Affymetrix. microarrays.
2015-08-03 | E-GEOD-70326 | biostudies-arrayexpress
Project description:Aire in medullary thymic epithelial cells plays an essential role in the negative selection through expression of broad arrays of tissue-restricted antigens. We asked whether Aire could also activate the expression of tissue-restricted antigens in cortical thymic epithelial cells.
2015-08-03 | GSE70326 | GEO
Project description:Aire is an important transcription regulator that mediates a role in central tolerance via promoting the promiscuous expression of tissue-specific antigens in the thymus. Although several mouse models of Aire-deficiency have been described, none has analysed the phenotype induced by a mutation that emulates the common 13bp deletion in human APECED by disrupting the first PHD domain in exon 8. Aire-deficient mice with a corresponding mutation showed some disturbance of the medullary epithelial compartment, but at the phenotypic level their T cell compartment appeared relatively normal in the thymus and periphery. An increase in the number of activated T cells was evident, and autoantibodies against several organs were detected. At the histological level, lymphocytic infiltration of several organs indicated the development of autoimmunity, though symptoms were mild and quality of life for Aire-deficient mice appeared equivalent to wild-type littermates, with the exception of male infertility. Vbeta and CDR3 length analysis suggested that each Aire-deficient mouse developed it own polyclonal autoimmune repertoire. Finally, given the prevalence of candidiasis in APECED patients, we examined the control of infection with Candida albicans in Aire-deficient mice. No increase in disease susceptibility was found for either oral or systematic infection. These observations support the view that additional genetic and/or environmental factors contribute substantially to the overt nature of autoimmunity associated with Aire mutations, even for mutations identical to those found in humans with APECED. Keywords: Gene expression comparison between genotypes In this experiment there are 5 samples altogether which consist of two biological replicates of Aire knock-out mTECs and 3 biological replicates of wild type mTECs.
2009-03-15 | E-GEOD-14365 | biostudies-arrayexpress
Project description:Autoimmune regulator (Aire) plays an indispensable role in the induction of central immune tolerance. We identify a novel subset of Rorγt-dependent innate lymphoid cell-type in secondary lymphoid organs, which presents endogenously generated antigens and contributes to peripheral T cell tolerance. In this experiment, transcriptomes of these Aire-ILC3 cells are characterized in wild-type Balb/C and Aire-/- Balb/C mice [Ramsey, C. et al. (2002) Hum Mol Genet 11:397-409] using RNA-seq method. To obtain the cells, peripheral lymph nodes were minced, enzymatically digested, and Aire-ILC3 cells were FACS-sorted as Lin-, MHCII+, CD80+, IL7Ra+ cells.
2019-03-14 | E-MTAB-7088 | biostudies-arrayexpress
Project description:Aire is an important transcription regulator that mediates a role in central tolerance via promoting the promiscuous expression of tissue-specific antigens in the thymus. Although several mouse models of Aire-deficiency have been described, none has analysed the phenotype induced by a mutation that emulates the common 13bp deletion in human APECED by disrupting the first PHD domain in exon 8. Aire-deficient mice with a corresponding mutation showed some disturbance of the medullary epithelial compartment, but at the phenotypic level their T cell compartment appeared relatively normal in the thymus and periphery. An increase in the number of activated T cells was evident, and autoantibodies against several organs were detected. At the histological level, lymphocytic infiltration of several organs indicated the development of autoimmunity, though symptoms were mild and quality of life for Aire-deficient mice appeared equivalent to wild-type littermates, with the exception of male infertility. Vbeta and CDR3 length analysis suggested that each Aire-deficient mouse developed it own polyclonal autoimmune repertoire. Finally, given the prevalence of candidiasis in APECED patients, we examined the control of infection with Candida albicans in Aire-deficient mice. No increase in disease susceptibility was found for either oral or systematic infection. These observations support the view that additional genetic and/or environmental factors contribute substantially to the overt nature of autoimmunity associated with Aire mutations, even for mutations identical to those found in humans with APECED. Keywords: Gene expression comparison between genotypes
2009-03-15 | GSE14365 | GEO
Project description:Promiscuous gene expression (pGE) of numerous self-antigens in thymic epithelial cells (TEC) enables the elimination of self-reactive T cells. The autoimmune regulator (Aire) is the only known molecular determinant driving pGE in the thymus but the existence of Aire-independent mechanisms has been inferred. Here, we analyzed the poly(A)+ transcriptome of TEC populations by RNA-sequencing (RNA-seq) in order to reveal differential features of Aire-induced vs. –independent pGE. We report an unanticipated effect of Aire deletion on the proliferation and differentiation of cortical TEC. Moreover, the RNA-seq data reveal the breath of Aire-induced and –independent pGE in medullary TEC (mTEC) subsets and the extent of thymic peripheral tissue representation. The results suggest that Aire-induced promiscuously expressed transcripts affect several functions with far reaching biological consequences in mTEC. High-throughput characterization of TEC transcriptomes will enable progress in understanding TEC biology and the establishment of self-tolerance. The mRNA profiles of cTEC, mTEClo and mTEChi from 6-8 week-old wild type (WT) and Aire-/- (KO) mice were generated by RNA-sequencing using Illumina HiSeq2000.
2015-05-19 | E-GEOD-65617 | biostudies-arrayexpress
Project description:Aire in medullary thymic epithelial cells plays an essential role in the establishment of self-tolerance through expression of broad arrays of tissue-restricted antigens. We asked what would happen if human AIRE is additively expressed in antigen-presenting cells in the thymus and periphery.
2019-05-25 | GSE99368 | GEO
Project description:We used the TriFecta TM (IDT, Integrated DNA Technologies, USA) anti-Aire siRNA sequence (GGAUUCUCUUUAAGGACUACAAUCTAGAUUGUAGUCCUUAAAGAGAAUCCUC) to silencing Aire mRNA. Confluent cultures of 3.10 mTEC cell line were transfected with 10 nM of anti-Aire siRNA using Hiperfect reagent (Qiagen) following manufacturers instructions. <br><br>After transfection, cells were cultured during 24 h in RPMI medium as above mentioned and total RNA was extracted using the mirVana kit (Ambion), which served as template for cDNA synthesis. Gene knockdown was confirmed by semi-quantitative reverse transcription PCR (RT-PCR) using the primers 5prim CATCCTGGATTTCTGGAGGA 3prim forward and 5prim GCTCTTTGAGGCCAGAGTTG 3prim reverse, which allowed amplification of a 253 bp PCR product corresponding to a segment of the Aire mRNA (cDNA). The PCR mix contained 200 uM dNTPs, 1.5 mM MgCl2, 50 mM KCl, 10 mM TRIS-HCl (pH 8.4), 10 uM each primer and 2 U Taq DNA polymerase. The cycling temperature was: 35 x 30 sec each (94oC, 57oC and 72oC). <br><br>An anti-HPRT siRNA included in this kit but whose sequence was not furnished was used in parallel to evaluate the efficiency of the gene knockdown assay on 3.10 mTEC cell line (data not shown).<br><br>
2009-08-30 | E-MEXP-2181 | biostudies-arrayexpress
Project description:Mutations in the gene encoding the transcription factor AutoImmune REgulator (AIRE) are responsible for the ‘Autoimmune PolyEndocrinopathy Candidiasis Ecodermal Dystrophy’ syndrome. AIRE directs expression of tissue restricted antigens in the thymic medulla and in lymph node stromal cells and thereby substantially contributes to induction of immunological tolerance to self-antigens. Data from experimental mouse models showed that AIRE-deficiency leads to impaired deletion of autospecific T cell precursors. However, a potential role for AIRE in the function of regulatory T cell populations, which are known to play a central role in prevention of immunopathology, has remained elusive. Regulatory T cells of CD8+CD28low phenotype efficiently control immune responses in experimental autoimmune and colitis models in mice. We here show that CD8+CD28low Treg from AIRE-deficient mice are transcriptionally and phenotypically normal, exert efficient suppression of in vitro immune responses, but completely fail to prevent experimental colitis in vivo. Our data therefore demonstrate that AIRE plays an important role in the in vivo function of a naturally occurring regulatory T cell population. Total RNA was extracted from CD8+CD28low regulatory T lymphocytes isolated from wildtype and Aire-deficient C57BL/6 mice for comparison of gene expression profiles.
2011-06-22 | E-GEOD-30129 | biostudies-arrayexpress