Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Knockdown of slc2a10/glut10 in zebrafish embryos vs. controls

ABSTRACT: A zebrafish model of arterial tortuosity syndrome (ATS) was generated by knocking down the slc2a10/glut10 gene using antisense morpholino oligonucleotides (MO). Control morpholino treated embryos were used as controls. The samples were collected for gene expression profiling at 48 hours post fertilization. Experimental details and analyzed data are available in Willaert et al. Human Molecular Genetics 2011; doi: 10.1093/hmg/ddr555

ORGANISM(S): Danio rerio

PROVIDER: GSE34508 | GEO | 2011/12/17

SECONDARY ACCESSION(S): PRJNA156329

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Similar Datasets

Knockdown of slc2a10/glut10 in zebrafish embryos vs. controls

Project description:A zebrafish model of arterial tortuosity syndrome (ATS) was generated by knocking down the slc2a10/glut10 gene using antisense morpholino oligonucleotides (MO). Control morpholino treated embryos were used as controls. The samples were collected for gene expression profiling at 48 hours post fertilization. Experimental details and analyzed data are available in Willaert et al. Human Molecular Genetics 2011; doi: 10.1093/hmg/ddr555 Two-condition experiment, slc2a10 MO (7.5ng) treatment vs control MO (5ng) treatment. Biological replicates: 3 slc2a10 MO replicates, compared to a pooled sample of 3 control MO replicates with dye swap.

2011-12-17 | E-GEOD-34508 | biostudies-arrayexpress

TGFb receptor 1 (TGFBR1) inhibitor treatment of zebrafish embryos vs. controls

2011-12-17 | GSE34509 | GEO

TGFb receptor 1 (TGFBR1) inhibitor treatment of zebrafish embryos vs. controls

Project description:The effect of transforming growth factor beta receptor 1 (TGFBR1) inhibitor (LY-364947) treatment was compared to untreated embryos. Experimental details and analyzed data are available in Willaert et al. Human Molecular Genetics 2011; doi: 10.1093/hmg/ddr555 Two-condition experiment, LY-364947 (40microM) treatment vs untreated controls. Biological replicates: 3 LY-364947 treatment replicates compared to a pooled sample of 3 untreated control replicates with dye swap.

2011-12-17 | E-GEOD-34509 | biostudies-arrayexpress

Identification of differentially-expressed genes between FoxH1 morpholino and control in zebrafish embryos.

Project description:The Forkhead Box H1 (FoxH1) protein is a co-transcription factor recruited by phosphorylated Smad2 downstream of several TGFbetas, including Nodal-related proteins. We have reassessed the function of zebrafish FoxH1 using antisense morpholino oligonucleotides (MOs) ( 5’ TGCTTTGTCATGCTGATGTAGTGGG 3’) as compared with a control morpholino (MO) with no specific target (5’ TAGTTAAGCCTAGCTCTCATAAACT 3’). Probing FoxH1 morphant RNA by microarray, we identified a cohort of five keratin genes – cyt1, cyt2, krt4, krt8 and krt18 - that are normally transcribed in the embryo’s enveloping layer (EVL) and which have significantly reduced expression in FoxH1-depleted embryos. Keywords: 40% epiboly-stage embryos, injected with either 8 ng of a 25mer morpholino (MO) with no specific target or 8 ng of a 25mer MO with reverse complementary to the 5’ untranslated region of the zebrafish foxH1 gene.

2007-07-30 | GSE8076 | GEO

YAMAT-seq of mature tRNA pools in the bacterium Escherichia coli str. K-12 substr. MG1655 and derivatives

Project description:Mature tRNA pools were measured using an adaptation of YAMAT-seq (Shigematsu et al., 2017; doi:10.1093/nar/gkx005 ) and further described in (Ayan et al., 2020; doi:10.7554/eLife.57947) in 10 strain-medium combinations (all strains dervied from the model bacterium E. coli MG1655). The aim of the experiment was to investigate the effect of reducing tRNA gene copy number on mature tRNA pools in rich and poor media.

2022-12-02 | GSE198606 | GEO

Gene expression changes in stage 23 Xenopus laevis embryos upon Neil2 knockdown

Project description:It was shown that neil2 is required for neural crest development in Xenopus (Schomacher et al. 2016; doi:10.1038/nsmb.3151). To gain further insights into the underlying molecular mechanism leading to neural crest defects and microcephaly in neil2 Morpholino injected Xenopus embryos, we performed RNA-seq transcriptome analysis of neil2 Morpholino versus control Morpholino injected embryos.

2019-09-16 | GSE130079 | GEO

Transcriptome analysis of the Zebrafish model of Diamond-Blackfan Anemia from RPS19 deficiency via p53-dependent and -independent pathways

Project description:To determine the effect on the whole transcriptome of RPS19 morpholino and to identify the function of p53 in RPS19-deficient embryos, we analyzed the genome-wide transcript profiles of control morpholino (control), RPS19 morpholino knockdown (RPS19 MO), and RPS19 and p53 morpholino knockdown simultaneously (RPS19+p53 MO) using the Illumina Hi-seq 2000 Genome Analyzer platform with paired-end 100 base-pair tags to a depth of 35-60 million reads. We found that genes enriched in the functions of hematological systems and nervous system development and that skeletal and muscular disorders had significant differential expression in RPS19 MO embryos compared with controls. Co-inhibition of p53 partially alleviates the abnormalities for RPS19-deficient embryos. However, the hematopoietic genes, which were down-regulated significantly in RPS19 MO embryos, were not completely recovered by the co-inhibition of p53. Furthermore, we identified the genome-wide p53-dependent and -independent genes and pathways. These results indicate that not only p53 family members but also several other factors have important impacts on RPS19-deficient embryos. The detection of potential pathogenic genes and pathways provides us a new paradigm for research on DBA, which is a systematic and complex hereditary disease.

2013-10-09 | GSE45699 | GEO

Single-cell transcriptional changes of spinal cord immune cells associated with Reg1-MO treatment during EAE neuroinflammation

Project description:Regnase-1 plays essential roles in restricting inflammation by acting as a RNase degrading mRNAs involved in immune reactions via the recognition of stem-loop structures in the 3'UTRs. Here we developed a novel therapeutic strategy to suppress inflammatory responses by upregulating Regnase-1 expression, which was enabled by the simultaneous use of two antisense morpholino oligonucleotides (MOs) to alter the stem-loop structures present in the Regnase-1 3'UTR and inhibit its auto-regulation. Intracranial Reg1-MO treatment successfully altenuated the disease severity of EAE, with significant delay in disease onset and lower incidence of paralysis. To clarify the cell types responsible for the suppression of autoimmune responses by Reg1-MOs in the CNS, we performed single-cell RNA sequencing (scRNA-seq) using the 10X Chromium platform using the spinal cord CD45+ cells derived from control and Reg1-MO groups collected at the peak of disease (D16). We found that Reg1-MO treatment not only stalled the microglial activation, but also increased the suppressive fucntion of regulatory T cells.

2022-03-28 | GSE182646 | GEO

Diminished OPA1 expression and impaired mitochondrial morphology and homeostasis in Aprataxin-deficient cells

Project description:Ataxia with oculomotor apraxia type 1 (AOA1) is an early onset progressive spinocerebellar ataxia caused by mutation in aprataxin (APTX). Here we use RNA-seq to identify genes that are affected by APTX-KO, APTX overexpression, and APTX mutant, thus contributes to understadning the mechanisms underlying AOA1 pathlogy. Published: https://academic.oup.com/nar/advance-article/doi/10.1093/nar/gkz083/5319145

2018-12-28 | GSE124412 | GEO

Proteomic comparisons of autophagy mutant, salicylic acid defiscient mutant and wild type plants grown in ideal nutrition and in low nitrate and low sulfate conditions.

Project description:Genotypes used are Arabidopsis thaliana (L.) Col-0 wild-type, atg5.3 mutant (SALK_020601), sid2.2 (Dewdney et al., 2000) and the atg5.3/sid2.2 double mutant that has been previously characterized by Yoshimoto et al. Plant Cell (2009). Plants were cultivated under control conditions (ideal nutrition N+S+; 10mM NO3- and 0.266mM SO42-), low nitrate (N-; 2 mM NO3- and 0.266mM SO42-), or low sulfate (S-; 10mM NO3- and 0.016mM SO42-) conditions, under in short days (160 micromol.m-2.s-1; 8 h light, 16 h dark) in growth chamber as described by Havé et al. 2019 New Phytologist. Rosettes were harvested at vegetative stage 60 days after sowing, 2-3 hours after the beginning of the photoperiod. Two consecutive cultures (C1 and C2) were performed at several month interval. For each culture, three plant repeats (R1-R3) were collected, each repeat was a mix of >6 rosettes. Details can be found in Havé et al. (2019) New Phytologist (doi: 10.1111/nph.15913). Associated publications are Havé et al. (2018) JXB (doi:10.1093/jxb/erx482), Havé et al. (2019) New Phytologist (doi: 10.1111/nph.15913) and Luo et al 2020 JXB (doi:10.1093/jxb/eraa337)

2023-10-27 | PXD029638 | Pride

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data