Genome-wide maps of binding sites of Nanog-like and Mxtx2 in blastula stage zebrafish embryos
Ontology highlight
ABSTRACT:
ORGANISM(S): Danio rerio
PROVIDER: GSE34683 | GEO | 2011/12/28
SECONDARY ACCESSION(S): PRJNA156233
REPOSITORIES: GEO
Similar Datasets
Project description:Here, using ChIP-Seq, we examined the targets of Nanog-like and Mxtx2 in blastula stage zebrafish embryos. We found that Nanog-like bind to its known targets like Oct4, Sox2, and Nanog-like. Nanog-like also bound to genes involved in extraembryonic lineage differentiation, like gata3 and krt4 for EVL differentiation, and mxtx2 and slc26a1 for YSL differentiation, mesoderm specification like ntl and tbx3, cell movement like wnt11 and cxcr4b, and signaling genes like ndr1, bmp2b, fgf8a and wnt8a. The binding profile suggests that Nanog-like may play a versatile role involving many developmental processes. We found 11.3% of the genes (1751 out of all annotated 15500 zebrafish genes) and 43.6% of the YSL genes (118 out of 271 genes expressed in the YSL) were bound by Mxtx2, suggesting Mxtx2 bound directly to YSL genes to activate their expression Examination of Nanog-like and Mxtx2 binding sites in 3.5hpf and 4.5hpf zebrafish embryos
2011-12-28 | E-GEOD-34683 | biostudies-arrayexpress
Project description:The Forkhead Box H1 (FoxH1) protein is a co-transcription factor recruited by phosphorylated Smad2 downstream of several TGFbetas, including Nodal-related proteins. We have reassessed the function of zebrafish FoxH1 using antisense morpholino oligonucleotides (MOs) ( 5’ TGCTTTGTCATGCTGATGTAGTGGG 3’) as compared with a control morpholino (MO) with no specific target (5’ TAGTTAAGCCTAGCTCTCATAAACT 3’). Probing FoxH1 morphant RNA by microarray, we identified a cohort of five keratin genes – cyt1, cyt2, krt4, krt8 and krt18 - that are normally transcribed in the embryo’s enveloping layer (EVL) and which have significantly reduced expression in FoxH1-depleted embryos. Keywords: 40% epiboly-stage embryos, injected with either 8 ng of a 25mer morpholino (MO) with no specific target or 8 ng of a 25mer MO with reverse complementary to the 5’ untranslated region of the zebrafish foxH1 gene.
2007-07-30 | GSE8076 | GEO
Project description:Using chromatin immunoprecipitation combined with microarrays we have identified targets of No tail (Ntl), a zebrafish Brachyury ortholog that plays a central role in mesoderm formation. We show that Ntl regulates a downstream network of other transcription factors and identify an in vivo Ntl binding site that resembles the consensus T-box binding site (TBS) previously identified by in vitro studies. We show floating head (flh) is a direct transcriptional target of Ntl in the notochord and that TBS in the flh upstream region are required for Ntl directed expression. Using this genome-scale data we have assembled a Gene Regulatory Network that describes mesoderm formation and patterning in the early zebrafish embryo and which predicts a role for Ntl in somite segmentation. Keywords: ChIP-chip Genomic array design. Microarrays were designed as described below and manufactured by Agilent Technologies (www.agilent.com). We have previously described the ChIP-chip technique in zebrafish and the design of promoter microarrays which cover a 2kb region around the transcription start sites (TSSs) of 11,512 zebrafish genes based on Zv4 (Wardle et al, 2006. Genome Biology 7:R71). In order to capture additional regulatory information further from the basal promoter region we also designed an expanded set of 60mer probes that cover 9kb upstream and 3kb downstream of the TSS of these genes using the same parameters as for the 2kb microarrays. We also incorporated several sets of control probes, both positive and negative. On each array there are 753 negative probes designed against zebrafish gene desert regions and Arabidopsis thaliana genes. In addition we included duplicates of promoter probes for several genes that we anticipated may be bound by factors of interest for this and other studies (wnt11, flh, vent, msgn1, myod, fgf8, pcdh8) and these probes are arrayed on both slides slide. We also included in this design 502 intensity control probes. Finally there are 2,256 controls added by Agilent. The final design contained 378,002 probes, including 365,537 experimental probes divided between nine microarray slides: slides 1-8 contained 40,616 experimental probes and slide 9 contained 40, 609. Further information on design and manufacture of the microarrays can be found on the Agilent Technologies website (www.agilent.com).
2009-02-19 | E-GEOD-12331 | biostudies-arrayexpress
Project description:Recent evidences have demonstrated phosphatidylinositol3-kinase (PI3-K)/Akt signaling pathway participates in cell growth, cell survival, and adipocyte differentiation in vitro. However, the in vivo evidence to support Akt function on adipogenesis is limited. To achieve this goal, we generated the stable zebrafish transgenics of Tg(krt4:myrAkt1)cy18 carrying human constitutive active form of Akt1 (myrAkt1) that driven by a skin-specific krt4 promoter. The Tg(krt4:myrAkt1)cy18 display severely skin hypertrophy at embryonic stages, and support Akt1 function as a key gene on cell size control. When transgenics reached sexual maturation, they display obese phenotype due to adipocyte hypertrophy and up-regulation of adipogenesis-related genes. Collectively, our findings provided a direct evidence to support Akt play provital roles on cell size control as well as adipogenesis in vivo. In addition, the obese zebrafish line of Tg(krt4:myrAkt1)cy18 provide a new platform to study obesity and its related chronic diseases mechanism in vivo.
2010-12-31 | GSE21756 | GEO
Project description:Using chromatin immunoprecipitation combined with microarrays we have identified targets of No tail (Ntl), a zebrafish Brachyury ortholog that plays a central role in mesoderm formation. We show that Ntl regulates a downstream network of other transcription factors and identify an in vivo Ntl binding site that resembles the consensus T-box binding site (TBS) previously identified by in vitro studies. We show floating head (flh) is a direct transcriptional target of Ntl in the notochord and that TBS in the flh upstream region are required for Ntl directed expression. Using this genome-scale data we have assembled a Gene Regulatory Network that describes mesoderm formation and patterning in the early zebrafish embryo and which predicts a role for Ntl in somite segmentation. Keywords: ChIP-chip
2009-02-19 | GSE12331 | GEO
Project description:The zebrafish genes spadetail (spt) and no tail (ntl) encode T-box transcription factors that are important for early mesoderm development. Although much has been done to characterize these genes, the identity and location of target regulatory elements remain largely unknown. Here, we survey the genome for downstream target genes of the Spt and Ntl T-box transcription factors. We find evidence for extensive additive interactions towards gene activation and limited evidence for combinatorial and antagonistic interactions between the two factors. Using in vitro binding selection assays to define Spt- and Ntl-binding motifs, we searched for target regulatory sequence via a combination of binding motif searches and comparative genomics. We identified regulatory elements for tbx6 and deltaD, and, using chromatin immunoprecipitation, in vitro DNA binding assays and transgenic methods, we provide evidence that both are directly regulated by T-box transcription factors. We also find that deltaD is directly activated by T-box factors in the tail bud, where it has been implicated in starting the segmentation clock, suggesting that spt and ntl act upstream of this process. Keywords: Morpholino Knockdown We measured transcript levels in zebrafish embryos at 75% epiboly. We compared levels in spadetail (spt) and/or no tail (ntl) morpholino injected embryos to those in control embryos mock injected with Danieau solution plus 0.25% phenol red. Three biological replicates are included for each treatment.
2010-05-19 | E-GEOD-12857 | biostudies-arrayexpress
Project description:Recent evidences have demonstrated phosphatidylinositol3-kinase (PI3-K)/Akt signaling pathway participates in cell growth, cell survival, and adipocyte differentiation in vitro. However, the in vivo evidence to support Akt function on adipogenesis is limited. To achieve this goal, we generated the stable zebrafish transgenics of Tg(krt4:myrAkt1)cy18 carrying human constitutive active form of Akt1 (myrAkt1) that driven by a skin-specific krt4 promoter. The Tg(krt4:myrAkt1)cy18 display severely skin hypertrophy at embryonic stages, and support Akt1 function as a key gene on cell size control. When transgenics reached sexual maturation, they display obese phenotype due to adipocyte hypertrophy and up-regulation of adipogenesis-related genes. Collectively, our findings provided a direct evidence to support Akt play provital roles on cell size control as well as adipogenesis in vivo. In addition, the obese zebrafish line of Tg(krt4:myrAkt1)cy18 provide a new platform to study obesity and its related chronic diseases mechanism in vivo. The AB strain of Zebrafish (Danio rerio) were obtained from ZIRC (http://zebrafish.org/zirc/home/guide.php), and kept in the stock of Chung Yuan Christian University. Zebrafish were raised in a local tap water at 28.0±0.5℃ and under a constant photoperiodism of 14 hour light cycle/10 hour dark cycle. Zebrafish embryos were collected in 10 cm diameter Petri dishes containing 20 mL fish water after spawning and raised at 28.0±0.5℃. To prevent the disease of Zebrafish embryo, few drops methylen blue were added into fish water. At 5 to 7 dpf, larvae were transferred to 10 liter tanks containing 8.0 liter of fish water and fed with living Paramecium. After 14 dpf, larvae were feed with living artemia (OSI, USA) until adulthood. We dissected two tail tissues (as a pooled sample) from six month-old wild-type and Tg(krt4:myrAkt1)cy18 (n=5), and homogenized in Trizol reagent (Ambion) to isolate total RNA according to the manufacture instruction. The RNA was treated with DNase I at 25℃ for 10 minutes to remove DNA contamination and then cleanup by RNase-free spin columns (Qiagen). The total RNA concentration was determined by spectrophotometry (ND-1000 ; NanoDrop Technol, Wilmington, DE), and the RNA quality was checked by running electrophoresis in RNA-denatured gels. All total RNA were stored at -20℃. For real-time quantitative RT-PCR, 1μg of total RNA were reverse-transcribed with reverse transcriptase and the excess RNA were digested E.coli RNase H to enhance the cDNA purity. The commercial Zebrafish 14K oligo microarray chip was obtained from Institute of Cellular and Organismic Biology at Academia Sinica and contained 14067 oligonucleotides represent 9666 unique genes with a redundancy of 31%. The detail oligonucleotide description can be obtained from Ocimun Biosolution (http://www.ocimumbio.com/web/default.asp). We used SuperScriptTM Indirect cDNA Labeling System kit (Invitrogen) to generate the fluorescently labeled probes. Total RNA isolated from WT and Tg(krt4:myrAkt1)cy18 were reversed transcribed into cDNA and coupling for Alexa Fluor 555 and Alexa Fluor 647 fluorescent dyes (Invitrogen), respectively. Before hybridization, the Zebrafish microarray chips were pretreated with 1% bovine serum albumin, 4X SCC, and 1% sodium dodecylsulfate (SDS) for 45min at 42℃, and then hybridized in SlideHybTM buffer (Ambion) for overnight at 42℃. After hybridization, chips were washed with 2X SSC and 0.5% SDS for 15min at 25℃ and finally with 0.5X SSC and 0.5% SDS for 15min at 25℃. The fluorescence intensities of Alexa Fluor 555 and Alexa Fluor 647 targets were scanned by Genepix scanner (Molecular Devices, Sunnyvale, CA, USA) and the acquired date were analyzed by Genepix and Genespring software (Aglient Technologies, Foster City, CA, USA).
2010-12-31 | E-GEOD-21756 | biostudies-arrayexpress
Project description:The zebrafish genes spadetail (spt) and no tail (ntl) encode T-box transcription factors that are important for early mesoderm development. Although much has been done to characterize these genes, the identity and location of target regulatory elements remain largely unknown. Here, we survey the genome for downstream target genes of the Spt and Ntl T-box transcription factors. We find evidence for extensive additive interactions towards gene activation and limited evidence for combinatorial and antagonistic interactions between the two factors. Using in vitro binding selection assays to define Spt- and Ntl-binding motifs, we searched for target regulatory sequence via a combination of binding motif searches and comparative genomics. We identified regulatory elements for tbx6 and deltaD, and, using chromatin immunoprecipitation, in vitro DNA binding assays and transgenic methods, we provide evidence that both are directly regulated by T-box transcription factors. We also find that deltaD is directly activated by T-box factors in the tail bud, where it has been implicated in starting the segmentation clock, suggesting that spt and ntl act upstream of this process. Keywords: Morpholino Knockdown
2008-09-20 | GSE12857 | GEO
Project description:The aim of this study was to identify genes that are regulated by Bmp signaling with the zebrafish heart at the heart cone stage around 21-23 hours post fertilization. In total, 4 samples based on cDNA from extracted cardiac tissue were analyzed: 2 samples of Tg(hsp70l:bmp2b)fr13 transgenic embryos heatshocked at 18 hpf and 2 WT control samples.
2013-03-25 | E-GEOD-43888 | biostudies-arrayexpress
Project description:Purpose: To understand the molecular mechanism between PNET2 and NTLs, we generated 35S:NTL-SRDX in pnet2_ab mutants to suppress NTL gene expression and performed the whole genome transcriptome analysis on 4-week-old plants of WT, pnet2_ab, 35S:NTL6-SRDX pnet2_ab, 35S:NTL9-SRDX pnet2_ab, and 35S:NTL12-SRDX pnet2_ab. Conclusions: PNET2 regulates diverse responses by associating with a family of membrane-bound transcriptional factors.
2024-04-19 | GSE230218 | GEO