Cytoplasmic Assembly and Selective Nuclear Import of Arabidopsis ARGONAUTE4/siRNA Complexes
Ontology highlight
ABSTRACT:
ORGANISM(S): Arabidopsis thaliana
PROVIDER: GSE36500 | GEO | 2012/07/12
SECONDARY ACCESSION(S): PRJNA153445
REPOSITORIES: GEO
Similar Datasets
Project description:Here we profiled small RNAs from whole cell, cytoplasmic and nuclear extracts from three-week-old Arabidopsis seedlings. We unexpectedly found that nuclear functional hc-siRNAs are predominantly present in the cytoplasm. Samples from Arabidopsis thaliana whole cell, cytoplasmic and nuclear extracts with 3 replicates for each. 9 samples in all.
2012-07-12 | E-GEOD-36500 | biostudies-arrayexpress
Project description:Transposable elements (TEs) and repetitive sequences comprise over 40% of rice genome. Different TEs are tightly regulated by distinct epigenetic mechanisms. For example, the activities of LTR retrotransposon Tos17 and non-LTR retrotransposon LINE element Karma are uniquely regulated by histone H3K9 methylation and histone H3K4 demethylation, respectively. Miniature inverted repeat transposable elements (MITEs) are one of the most high-copy-number DNA transposons, which are interspersed around rice genome and might influence nearby gene expression. In plants, 24-nucleotide (24-nt) heterochromatic small interfering RNAs (hc-siRNAs) derived from repeats and TEs. To what extent hc-siRNA associated TEs affect gene expression and therefore contribute to agricultural traits in rice remains elusive. Here, we show that OsDCL3a, one of Dicer-Like 3 (DCL3) homolog, is primarily responsible for 24-nt hc-siRNA processing in rice. Impaired OsDCL3a displayed altered important agricultural traits in rice. We found that genome-wide (281,563) 24-nt hc-siRNA clusters were OsDCL3a-dependent, among which MITEs were significantly enriched. Impaired OsDCL3a caused significant overlapping between reduced hc-siRNAs from MITEs and elevated nearby gene expression. Intriguingly, genes involved in Gibberellin and Brassinosteroid homeostasis were identified as direct targets of OsDCL3a, which may attribute to dwarfism and enlarged flag leaf angle upon OsDCL3a deficiency. Our work uncovers OsDCL3a-dependent hc-siRNAs derived from MITEs as broad spectrum of regulators for fine-tuning gene expression, and this observation may reflect a conserved mechanism in other higher plants with dispersed repeat- or TE-rich genomes. Examination of OsDCL3a-dependent hc-siRNAs derived from MITEs.
2014-02-04 | E-GEOD-50778 | biostudies-arrayexpress
Project description:Transposable elements (TEs) and repetitive sequences comprise over 40% of rice genome. Different TEs are tightly regulated by distinct epigenetic mechanisms. For example, the activities of LTR retrotransposon Tos17 and non-LTR retrotransposon LINE element Karma are uniquely regulated by histone H3K9 methylation and histone H3K4 demethylation, respectively. Miniature inverted repeat transposable elements (MITEs) are one of the most high-copy-number DNA transposons, which are interspersed around rice genome and might influence nearby gene expression. In plants, 24-nucleotide (24-nt) heterochromatic small interfering RNAs (hc-siRNAs) derived from repeats and TEs. To what extent hc-siRNA associated TEs affect gene expression and therefore contribute to agricultural traits in rice remains elusive. Here, we show that OsDCL3a, one of Dicer-Like 3 (DCL3) homolog, is primarily responsible for 24-nt hc-siRNA processing in rice. Impaired OsDCL3a displayed altered important agricultural traits in rice. We found that genome-wide (281,563) 24-nt hc-siRNA clusters were OsDCL3a-dependent, among which MITEs were significantly enriched. Impaired OsDCL3a caused significant overlapping between reduced hc-siRNAs from MITEs and elevated nearby gene expression. Intriguingly, genes involved in Gibberellin and Brassinosteroid homeostasis were identified as direct targets of OsDCL3a, which may attribute to dwarfism and enlarged flag leaf angle upon OsDCL3a deficiency. Our work uncovers OsDCL3a-dependent hc-siRNAs derived from MITEs as broad spectrum of regulators for fine-tuning gene expression, and this observation may reflect a conserved mechanism in other higher plants with dispersed repeat- or TE-rich genomes.
2014-02-04 | GSE50778 | GEO
Project description:AGO protein immunoprecipitation was combined with high-throughput sequencing of associated small RNAs. AGO2, AGO10, and to a lesser extent AGO1 were shown to associate with siRNAs derived from silencing suppressor (HC-Pro)-deficient TuMV-AS9, but not with siRNAs derived from wild-type TuMV. Co-immunoprecipitation and small RNA sequencing revealed that viral siRNAs broadly associated with wild-type HC-Pro during TuMV infection. These results support the hypothesis that suppression of antiviral silencing during TuMV infection, at least in part, occurs through sequestration of virus-derived siRNAs away from antiviral AGO proteins by HC-Pro.
2015-04-06 | GSE64911 | GEO
Project description:This data from co-immunoprecipitation (co-IP) using YFP-Trap magnetic beads followed by mass spectrometry, using protein extracts prepared from the chloroplast fraction of cells expressing YFP-ATG8or YFP-HA.
2023-03-14 | PXD040844 |
Project description:IL-33 is a nuclear cytokine from the IL-1 family that plays important roles in health and disease. Under healthy conditions, IL-33 is constitutively expressed to high levels in the nucleus of producing cells in various human and mouse tissues. The extracellular function of IL-33 cytokine has been well documented, but it remains unclear whether intracellular nuclear IL-33 has additional functions in the nucleus. Here, we used a global proteomic approach based on quantification of 5000 individual proteins by high-resolution mass spectrometry to compare the extracellular and intracellular roles of IL-33 in primary human endothelial cells, a major source of IL-33 protein in human tissues. Large-scale analysis of protein expression was performed either after stimulation of the cells with the IL-33 mature form IL-3395-270 (during 6h or 24h) or after siRNA knockdown of intracellular IL-33 (two experiments, each with a different pool of distinct siRNAs, noted siRNA1 and siRNA2). In each case, proteins were fractionated by 1D SDS-PAGE in 12 gel bands, and label-free quantitative analysis was performed. The present dataset contains the files for the two experiments of knockdown of endogenous nuclear IL-33 expression: - RNA silencing strategy 1. Knockdown of endogenous nuclear IL-33 expression was performed with a pool of four distinct siRNAs (Dharmacon ON-TARGETplus SMARTpool IL-33 siRNAs) that have been specifically modified for efficient silencing of the target gene with reduced off-target effects. Cells transfected with these siRNA duplexes (si1) were compared with those transfected with the provided controls (CTsi1). Three independent biological replicates (noted _A, _B, _C) were prepared and analyzed for each condition, leading to 6 different samples. Each of them was fractionated into 12 gel bands analyzed by nanoLC-MS/MS, leading to 72 raw files. - RNA silencing strategy 2. The second knockdown strategy was based on the use of an independent pool of three siRNAs targeting IL-33, predesigned by another provider using new and critical siRNA design rules (Sigma MISSION Predesigned Il-33 siRNAs based on Rosetta siRNA design algorithm). Cells transfected with these siRNA duplexes (si2) were compared with those transfected with the provided controls (CTsi2). Three independent biological replicates (noted _A, _B, _C) were prepared and analyzed for each condition, leading to 6 different samples. Each of them was fractionated into 12 gel bands analyzed by nanoLC-MS/MS, leading to 72 raw files.
2016-10-12 | PXD004141 | Pride
Project description:In this study, we aim at understanding which RNA degradation pathways are involved in keeping the secondary siRNA production in check in Arabidopsis thaliana. We have sequenced small RNAs from various T-DNA insertation single mutants and compared their capability of producing ectopic secondary siRNAs from endogenous miRNA targets. The mutants used in the work stem from three library pools from three different experiments. Libraries from all three experiments are submitted together here. The experiments can be distinguished by their title and their tag:experiment. There is a matrix of normalized reads from each pool of library as well called normalizedExp1.txt, normalizedExp2.txt and normalizedExp3.txt
2021-04-28 | GSE173426 | GEO
Project description:DSCAM and DSCAML1 are immunoglobulin and cell adhesion-type receptors serving important neurodevelopmental functions including control of axon growth, branching, neurite self-avoidance and neuronal cell death. The signal transduction mechanisms or effectors of DSCAM receptors however, remain poorly characterized. We used a human ORFeome library to perform a high-throughput screen in mammalian cells and identified novel cytoplasmic signaling effector candidates including the Down syndrome kinase Dyrk1a, STAT3, USP21, and SH2D2A. Unexpectedly, we further found that the intracellular domains (ICDs) of DSCAM and DSCAML1 specifically and directly interact with IPO5, a nuclear import protein of the beta-importin family, via a conserved nuclear localization signal. The DSCAM ICD is released by gamma-secretase dependent cleavage and both the DSCAM and DSCAML1 ICDs efficiently translocate to the nucleus. Furthermore, RNA-sequencing confirms that expression of the DSCAM as well as the DSCAML1 ICDs alone can profoundly alter the expression of genes associated with neuronal differentiation and apoptosis, as well as synapse formation and function. Gain-of-function experiments using primary cortical neurons show that increasing the levels of either the DSCAM or the DSCAML1 ICD leads to an impairment of neurite growth. Strikingly, increased expression of either full-length DSCAM or the DSCAM ICD, but not the DSCAML1 ICD, significantly decreases synapse numbers in primary hippocampal neurons. Taken together, we identified a novel membrane-to-nucleus signaling mechanism by which DSCAM receptors can alter the expression of regulators of neuronal differentiation, synapse formation and function. Considering that chromosomal duplications lead to increased DSCAM expression in trisomy 21 our findings may help to uncover novel mechanisms contributing to intellectual disability in Down syndrome.
2019-02-08 | GSE122568 | GEO
Project description:AGO protein immunoprecipitation was combined with high-throughput sequencing of associated small RNAs. AGO2, AGO10, and to a lesser extent AGO1 were shown to associate with siRNAs derived from silencing suppressor (HC-Pro)-deficient TuMV-AS9, but not with siRNAs derived from wild-type TuMV. Co-immunoprecipitation and small RNA sequencing revealed that viral siRNAs broadly associated with wild-type HC-Pro during TuMV infection. These results support the hypothesis that suppression of antiviral silencing during TuMV infection, at least in part, occurs through sequestration of virus-derived siRNAs away from antiviral AGO proteins by HC-Pro. Catalytic mutant HA-AGO1-DAH, HA-AGO2-DAD and HA-AGO10-DAH or catalytically active HA-AGO10-DDH were immunoprecipitated from buffer (mock) or inoculated rosette leaves (at 7 dpi) or noninoculated cauline leaves at 10 dpi with wt TuMV or suppressor-deficient TuMV-AS9. Inflorescence from TuMV infected plants was collected at 10 dpi with wt TuMV. HC-Pro was tagged with 6xHIS in TuMV-HIS and suppressor-deficient TuMV-HIS-AS9. HC-Pro was immunoprecipitated from noninoculated cauline leaves of inflorescence at 10 dpi. HC-Pro AS9 was immunoprecipitated from noninoculated cauline leaves at 15 dpi. Total RNA was extracted from input fraction and small RNAs separated by size fractionation. Small RNAs in input and HA-AGO or HC-Pro immunoprecipitation fractions were converted to DNA Amplicons by 5' (GUUCAGAGUUCUACAGUCCGACGAUC) or 3’ (CTGTAGGCACCATCAAT) adaptor ligation followed by RT-PCR. DNA Amplicons were sequenced using the Illumina HiSeq2000 platform. Duplicate libraries were made per treatment. For each library, hits to TuMV, to TuMV-HIS and to Arabidopsis thaliana were included in separate files.
2015-04-06 | E-GEOD-64911 | biostudies-arrayexpress
Project description:RNAseIII ribonucleases act at the heart of RNA silencing pathways by processing precursor RNAs into mature microRNAs and siRNAs. In the fission yeast Schizosaccharomyces pombe, siRNAs are generated by the RNAseIII enzyme Dcr1 and are required for heterochromatin formation. In this study, we have analyzed the subcellular localization of Dcr1 and found that it accumulates in the nucleus and is enriched at the nuclear periphery. Nuclear accumulation of Dcr1 depends on a short motif which constrains nuclear export promoted by the double-stranded RNA binding domain of Dcr1. Absence of this motif renders Dcr1 mainly cytoplasmic and is accompanied by remarkable changes in gene expression and failure to assemble heterochromatin. Our findings suggest that dicer proteins are shuttling proteins and that the steady-state subcellular levels can be shifted towards either compartment. This has implications for the mechanism of RNAi-mediated heterochromatin assembly and the spatial organization of RNA silencing pathways in general. Small RNA libraries from total RNA isolations of wild-type, dcr1Delta and dcr1DeltaC33 cells and subjected to high-throughput sequencing.
2010-02-16 | E-GEOD-18582 | biostudies-arrayexpress